About Us | Help Videos | Contact Us | Subscriptions
 

Crop Science - Crop Wild Relatives Special Section

Meiotic Homoeologous Recombination-Based Alien Gene Introgression in the Genomics Era of Wheat

 

This article in CS

  1. Vol. 57 No. 3, p. 1189-1198
    unlockOPEN ACCESS
     
    Received: Sept 29, 2016
    Accepted: Dec 02, 2016
    Published: June 16, 2017


    * Corresponding author(s): xiwen.cai@ndsu.edu
 View
 Download
 Alerts
 Permissions
Request Permissions
 Share

doi:10.2135/cropsci2016.09.0819
  1. Wei Zhanga,
  2. Yaping Caoa,
  3. Mingyi Zhanga,
  4. Xianwen Zhua,
  5. Shuangfeng Rena,
  6. Yuming Longa,
  7. Yadav Gyawalia,
  8. Shiaoman Chaob,
  9. Steven Xub and
  10. Xiwen Cai *a
  1. a  Dep. of Plant Sciences, North Dakota State Univ., Fargo, ND 58108
    b  USDA–ARS, Red River Valley Agricultural Research Center, Fargo, ND 58102

Abstract

Wheat (Triticum spp.) has a narrow genetic basis due to its allopolyploid origin. However, wheat has numerous wild relatives usable for expanding genetic variability of its genome through meiotic homoeologous recombination. Traditionally, laborious cytological analyses have been employed to detect homoeologous recombination. This has limited the progress of alien gene introgression in wheat improvement. Here, we used the ph1b mutant and high-throughput genotyping technologies to identify and facilitate homoeologous recombination-based alien gene introgression. Genotypes homozygous for ph1b and heterozygous for wheat chromosome 2B and its homoeologue in the wild species Aegilops speltoides Tausch (2S) and Thinopyrum elongatum (Host) D. R. Dewey (2E) were constructed to enhance 2B–2S and 2B–2E meiotic pairing and recombination. Backcross populations were subsequently developed to effectively recover and detect 2B–2S and 2B–2E homoeologous recombination events using the high-throughput, chip-based single-nucleotide polymorphism (SNP) assay and uniplex SNP-derived polymerase chain reaction (PCR) markers. This DNA marker-mediated approach will enhance the recovery and detection of meiotic homoeologous recombination for alien gene introgression and boost the utilization of alien genes in wheat improvement.


Abbreviations

    AS, allele-specific; CS, Chinese Spring; DAPI, 4′,6-diamidino-2-phenylindole; DS, disomic substitution; FAM, fluorescein amidite; FGISH, fluorescent genomic in situ hybridization; FITC, fluorescein isothiocyanate; HEX, hexachloro-fluorescein; PCR, polymerase chain reaction; PEA, priming-element-adjustable; SNP, single-nucleotide polymorphism; SSR, simple sequence repeat; STS, sequence-tagged site

Wheat (Triticum spp.) is one of the major food crops in the United States and worldwide. However, wheat production has been continually challenged by various threats and pressures, such as climate variability and change, new disease pathogens and pests, and a constantly growing food demand (Mujeeb-Kazi et al., 2013). There is a constant need to strengthen the defense of wheat against various new threats and improve wheat productivity. The genetic gain for wheat production has declined, due primarily to the draining of the usable genepool in wheat breeding (Graybosch and Peterson, 2010). The limited genetic variability of the wheat genome has increasingly become a bottleneck for wheat improvement. There is an urgent need to enrich the genepool of wheat and expand genetic variability of the wheat genome.

Common wheat (Triticum aestivum L., 2n = 6x = 42, genome AABBDD) is an allohexaploid with three distinct but genetically related subgenomes (i.e., A, B, and D). Homoeologous chromosomes in the three subgenomes can genetically compensate for each other. The allopolyploid nature enables common wheat to tolerate various chromosome modifications, providing tremendous genetic flexibility for wheat improvement by chromosome manipulation (Morris and Sears, 1967). Over the years, a series of studies have demonstrated that the wheat genome can be artificially reshaped and enriched in terms of genomic structure and gene content through chromosome engineering (Sears, 1972, 1983; Zeller, 1973; Zeller and Hsam, 1983; Gale and Miller, 1987; Shepherd and Islam, 1988; Friebe et al., 1996; Cox, 1997; Xu et al., 2005; Qi et al., 2007, 2008; Niu et al., 2011; Klindworth et al., 2012; McArthur et al., 2012).

Chromosome engineering is the process of modifying ploidy, chromosome structure, and/or chromosome number of an organism for the purpose of genetic improvement. This technology has been used to incorporate favorable genes from wild species into the wheat genome for germplasm and variety development. Alien genes can be introduced into wheat from wild species through chromosome addition, substitution, and translocation. Alien chromosome addition and substitution, which introduce one or more entire alien chromosomes into the wheat genome, usually contain desirable genes, as well as undesirable genes, on the alien chromosomes. It is generally difficult to utilize those lines directly in wheat breeding. Chromosome translocation, which integrates alien chromosome segments containing the gene of interest into the wheat genome, has been the most effective approach for alien gene introgression (Sears, 1983; Jiang et al., 1994; Friebe et al., 1996; Cai et al., 2005; Chen et al., 2005; Xu et al., 2005; Kuraparthy et al., 2007; Faris et al., 2008; Niu et al., 2011; Klindworth et al., 2012). Small compensating wheat–alien chromosome translocations are less likely to contain undesirable genes and are more breeder friendly for variety development than alien chromosome addition and substitution lines (Sears, 1972, 1983; Zeller, 1973; Zeller and Hsam, 1983; Shepherd and Islam, 1988; Friebe et al., 1996; Qi et al., 2007, 2008; Niu et al., 2011; Klindworth et al., 2012). The compensating translocations generally result from meiotic recombination between wheat chromosomes and their homoeologous counterparts from wild species.

The Ph1 gene on wheat chromosome 5B limits meiotic pairing and recombination to homologous chromosomes and prevents homoeologous chromosomes from pairing and recombination to each other (Riley and Chapman, 1958). It ensures the integrity of the wheat genome but also limits the introduction of genetic variability from wild species into wheat by meiotic homoeologous recombination. Genetic stocks involving the ph1 mutant, the Ph1 inhibitor gene, chromosome 5D(5B) substitution in durum wheat (Triticum durum Desf.), and chromosome 5D(5B) nulli-tetrasomics in bread wheat have been used to suppress Ph1 activity and promote meiotic pairing and recombination between homoeologous chromosomes for alien gene introgression in wheat (Riley et al., 1959; Chapman and Riley, 1970; Wang et al., 1977; Chen et al., 1994; Qi et al., 2007, 2008; Niu et al., 2011; Klindworth et al., 2012). Out of these genetic stocks, the ph1b mutant resulting from a large deletion on the long arm of chromosome 5B (5BL) (Sears, 1977; Gill et al., 1993) has been widely utilized to induce meiotic homoeologous pairing and recombination for alien gene introgression in wheat.

Meiotic homoeologous pairing and recombination can be enhanced by disabling Ph1 activity but usually remains at a low frequency. Thus, a large recombination population is generally required to recover the homoeologous recombinants of interest. Screening such a large recombination population for the recombinants of interest is always a challenge for any cytological techniques, including genomic in situ hybridization (GISH). Recent advances in genome studies, especially high-throughput genotyping technologies, have opened new opportunities to improve the efficacy of homoeologous recombinant screening and alien gene introgression. This study aimed to develop an effective procedure of inducing, recovering, and detecting meiotic homoeologous recombination for alien gene introgression using the genomics tools and resources currently available in wheat.


MATERIALS AND METHODS

Plant Materials

‘Chinese Spring’ (CS) wheat–Aegilops speltoides Tausch (2n = 2x = 14, genome SS) disomic substitution line 2S(2B) [DS 2S(2B)] (Friebe et al., 2011) and CS ph1b mutant were supplied by the Wheat Genetics Resource Center at Kansas State University. The CS–Thinopyrum elongatum (Host) D. R. Dewey (2n = 2x = 14, genome EE) disomic substitution line 2E(2B) [DS 2E(2B)] was provided by J. Dvorak at University of California, Davis.

Fluorescent Genomic in Situ Hybridization (FGISH)

Fluorescent genomic in situ hybridization (FGISH) was performed as described by Cai et al. (1998). Total genomic DNA of Ae. speltoides and Th. elongatum was labeled with biotin-16-dUTP by nick translation (Enzo Life Sciences, Inc.) and used as probe DNA. Total genomic CS DNA was sheared by boiling in 0.4 M NaOH for 40 to 50 min and used as blocking DNA. Hybridization signals were detected with fluorescein isothiocyanate-conjugated avidin (FITC-avidin) and wheat chromatin was counter stained with 4′-6-Diamidino- 2-phenylindole (DAPI). Aegilops speltoides/Th. elongatum chromatin (painted yellow-green) and wheat chromatin (painted red) were differentiated under a fluorescence microscope (BX51, Olympus).

Molecular Marker Analyses

Simple Sequence Repeat (SSR) and Sequence-Tagged Site (STS)

Two sequence-tagged site (STS) markers (PSR128 and PSR574) that tag the Ph1 allele were used to identify individuals homozygous for the ph1b deletion (Roberts et al., 1999). The STS marker Xwgc1079, mapped on chromosome 3A (X. Cai et al., unpublished data, 2013), was employed as an internal control for the polymerase chain reaction (PCR) of PSR128 and PSR574, since they did not produce any amplicon with the ph1b deletion. Two chromosome-specific simple sequence repeat (SSR) markers, Xwmc474 and Xgwm455, were used to identify Ae. speltoides chromosome 2S and Th. elongatum chromosome 2E, respectively. The DNA extraction was performed as described by Niu et al. (2011). The PCR was run at an annealing temperature required by the markers. The PCR products were separated in a non-denatured polyacrylamide gel system (Chen et al., 2007).

Single-Nucleotide Polymorphism (SNP)

The wheat 90K single-nucleotide polymorphism (SNP) genotyping assay was performed on the Illumina iScan instrument according to the manufacturer’s protocols (Illumina, Inc.). The SNP allele clustering and genotype calling were performed using the GenomeStudio version 2011.1 software (Illumina, 2011), as described by Wang et al. (2014).

SNP-derived PCR markers

Wheat SNPs mapped within the critical chromosome regions were converted into PCR-based length polymorphic markers following the procedure of Long et al. (2016) and Qi et al. (2015). Three primers were designed from the contextual sequence of a target SNP, including two-tailed, allele-specific forward primers (AS-primers F1 and F2) and one common reverse primer. Two universal priming-element-adjustable primers (PEA1 and PEA2) attached with the fluorescence tags FAM and HEX at the 5′ terminus, respectively, were used to generate length polymorphism between the AS primer-amplified products. Each of the PEA primers contained a piece of DNA sequence identical to a specific tail sequence (Tail 1 or Tail 2) in the AS primers. In addition, a 4-base oligonucleotide (5′-AGAG-3′) was inserted into PEA2 to generate length polymorphism between two alleles after amplification. The fluorescence intensity of PCR products amplified by the dual-labeled PEA primers was measured in a CFX384 real-time PCR machine at 33°C. Alleles amplified at some SNP loci could not be clearly detected by a real-time PCR machine due to the homoeoallelic interference in wheat. Accordingly, those PCR products were sorted to identify the alleles of interest based on the length polymorphism generated in this procedure using an IR2 4300/4200 DNA analyzer (LI-COR, Inc.). Both PEA primers were labelled with IRDye 700 fluorophore at the 5′ end.


RESULTS

Induction and Recovery of Meiotic Homoeologous Recombination

The CS wheat–Ae. speltoides × Th. elongatum disomic substitution lines DS 2S(2B) and DS 2E(2B) were verified by FGISH and used as the source materials of Ae. speltoides chromosome 2S and Th. elongatum chromosome 2E in this study (Fig. 1). These two alien chromosomes under group 2 were introduced into the CS wheat background without Ph1 (i.e., ph1bph1b) as a heterozygous condition, i.e., 2S + 2B and 2E + 2B, respectively. This was done by crossing and backcrossing each of these two substitution lines with the CS ph1b mutant (ph1bph1b) to develop a BC1F1 population segregating for Ph1/ph1b as well as chromosome 2B/2S or 2B/2E. Approximately 25% individuals in each of the BC1F1 populations were expected to be homozygous for ph1b and heterozygous for 2B/2S or 2B/2E (i.e., ph1bph1b + 2B + 2S or ph1bph1b + 2B + 2E) if the gametes with different genotypes and chromosome constitutions had an equal transmission rate. A total of 74 individuals from the 2B/2S BC1F1 population and 97 from the 2B/2E population were first screened for the ph1b homozygotes using the Ph1-specific molecular marker PSR128 or PSR574 (Roberts et al., 1999). Thirty-nine individuals homozygous for ph1b were selected from the 2B/2S population and 43 from the 2B/2E population. Meanwhile, we identified a codominant SSR marker (Xwmc474) specific for the 2B–2S homoeologous pair and another one (Xgwm455) for 2B–2E. The selected ph1b homozygotes were further screened for 2B/2S and 2B/2E heterozygotes using these two chromosome-specific markers (i.e., Xwmc474 and Xgwm455). Nine 2B/2S heterozygotes and sixteen 2B/2E heterozygotes were selected from the ph1b homozygotes using Xwmc474 and Xgwm455, respectively, as illustrated in Fig. 2. Segregation of the homoeologous pair 2B–2E fitted in a 1:1 segregation ratio, while 2B–2S did not. Overall, chromosome 2B had a higher transmission rate than chromosome 2E and 2S (Table 1). The 2B/2S and 2B/2E heterozygotes were further confirmed by FGISH of meiotic chromosomes. Meiotic homoeologous pairing was observed between chromosomes 2B and 2S and between 2B and 2E in the homozygous ph1b background (Fig. 3).

Fig. 1.
Fig. 1.

Fluorescent genomic in situ hybridization (FGISH) patterns of mitotic chromosomes in (a) DS 2S(2B) and (b) DS 2E(2B). Aegilops speltoides chromosome 2S and Th. elongatum chromosome 2E were painted in yellow-green and wheat chromosomes in red. Arrows point to chromosome 2S and 2E, respectively. Scale bar = 10 μm.

 
Fig. 2.
Fig. 2.

Selection of the 2B/2S heterozygote (2B + 2S) by the simple sequence repeat (SSR) marker Xwmc474 (top) and the 2B/2E heterozygote (2B + 2E) by the SSR marker Xgwm455 (bottom). “M” refers to size marker and “*” indicates the heterozygotes selected.

 

View Full Table | Close Full ViewTable 1.

Segregation of 2B–2S and 2B–2S homoeologous pairs in the BC1F1 populations

 
Ph1bph1b
Homoeologous pairs No. BC1F1 plants screened 2B + 2B 2B + 2S or 2B + 2E χ2 (1:1) Probability
2B–2S 74 30 9 11.31 0.001
2B–2E 97 27 16 2.81 0.093
Fig. 3.
Fig. 3.

Fluorescent genomic in situ hybridization (FGISH) patterns of meiotic chromosomes showing 2B–2S and 2B–2E homoeologous pairing (rod bivalent) in (a) the BC1F1 individual heterozygous for chromosomes 2B/2S and homozygous for ph1b, and (b) the BC1F1 individual heterozygous for chromosomes 2B/2E and homozygous for ph1b. Aegilops speltoides chromosome 2S and Th. elongatum chromosome 2E were painted in yellow-green and wheat chromosomes in red. Scale bar = 10 μm.

 

Molecular Marker-Assisted Detection of Meiotic Homoeologous Recombinants

The plants identified as homozygous for ph1b and heterozygous for 2B/2S or 2B/2E were crossed with their respective substitution line DS 2S(2B) or DS 2E(2B) to recover the gametes that contained 2B–2S or 2B–2E recombinant chromosomes. From those crosses, a large population (n > 1000) was constructed to recover the recombinants for each of these two homoeologous pairs. As expected, each of these two populations contained two major classes of individuals according to their compositions for chromosome 2B, 2S, and 2E. One class contained a 2B–2S or 2B–2E recombinant chromosome, in addition to a complete chromosome 2S or 2E from the substitution line parent. The other class contained nonrecombinant chromosomes with three different chromosome combinations in each population, including 2B + 2B, 2B + 2S, and 2S + 2S for the 2B/2S population and 2B + 2B, 2B + 2E, and 2E + 2E for the 2B/2E population. We performed a preliminary screening of these two populations by FGISH to select 2B–2S and 2B–2E recombinants for investigating molecular marker-assisted detection of homoeologous recombination.

Homoeologous 2B–2S and 2B–2E recombinants were identified from these two recovery populations by FGISH. Two 2B–2S recombinants (2SS–2BS ⋅ 2BL) designated R1 and R3 and two 2B–2E recombinants designated R2 (2BS–2ES ⋅ 2EL) and R4 (2ES ⋅ 2EL–2BL) were used to investigate the utility of molecular markers in the detection of homoeologous recombinants in this study (Fig. 4B, 5B, and 6). These four recombinants, along with CS, DS 2B(2S), DS 2B(2E), 2B/2S heterozygote (2B + 2S), 2B/2E heterozygote (2B + 2E), and several other recombinants, were genotyped by wheat 90K iSelect SNP arrays. A total of 3158 SNP loci were surveyed for polymorphisms among chromosomes 2B, 2S, and 2E. Both dominant and codominant SNPs were identified for the 2B–2S and 2B–2E homoeologous pairs, as illustrated in Fig. 4. Codominance was observed at the SNP locus Kukri_c30847_344 mapped to the distal end of 2BS between chromosome 2B and 2S (Fig. 4A). Dominance was observed at the SNP locus BS00067828_51 mapped to the distal end of 2BL between chromosome 2B and 2S with a null allele on 2SL (Fig. 4C). As expected, we detected null alleles at some of the SNP loci on chromosome 2S and 2E because the 90K SNP arrays were developed from the transcriptomes of modern wheat accessions.

Fig. 4.
Fig. 4.

Genotyping of ‘Chinese Spring’ (CS) wheat, 2S/2B heterozygote (2S + 2B), DS 2S(2B), and 2B–2S recombinant R3 (2SS–2BS ⋅ 2BL) using the wheat 90K single-nucleotide polymorphism (SNP) arrays. (A) Genotype clusters with the codominant SNP Kukri_c30847_344 mapped to the distal end of 2BS (Wang et al., 2014); (B) fluorescent genomic in situ hybridization (FGISH) pattern of R3; (C) genotype clusters of the dominant SNP BS00067828_51 mapped to the distal end of 2BL (Wang et al., 2014). Clusters were generated by GenomeStudio version 2011.1 software (Illumina, 2011).

 
Fig. 5.
Fig. 5.

Application of single-nucleotide polymorphism (SNP)-derived length polymorphic polymerase chain reaction (PCR) markers in the detection of 2B–2S and 2B–2E homoeologous recombination. (A) Chromosome ideogram showing homoeologous recombination and locations of the three SNP-derived PCR markers (top) and expected haplotypes of the chromosomes at the marker loci (bottom). Open bars refer to chromosome 2B and its segments in the recombinants, and filled bars to chromosome 2S or 2E and their segments in the recombinants. (B) Left: Genotypes of ‘Chinese Spring’ (CS) (lane 1), negative control (H2O) (lane 2), DS 2S(2B) (lane 3), DS 2E(2B) (lane 4), 2B/2S heterozygote (2B + 2S) (lane 5), 2B/2E heterozygote (2B + 2E) (lane 6); recombinant R1 (2SS–2BS ⋅ 2BL) (lane R1), and recombinant R2 (2BS–2ES ⋅ 2EL) (lane R2) at the three marker loci. Right: fluorescent genomic in situ hybridization (FGISH) patterns of the recombinant chromosome 2SS–2BS ⋅ 2BL (R1) and 2BS–2ES ⋅ 2EL (R2). Segments of chromosome 2B were painted in red, while segments from chromosome 2S and 2E were painted in yellow-green.

 
Fig. 6.
Fig. 6.

Identification of the homozygous 2B–2E recombinant R4 (2ES ⋅ 2EL–2BL) using the codominant single-nucleotide polymorphism (SNP)-derived polymerase chain reaction (PCR) marker Xwgc1603. (A) Fluorescent genomic in situ hybridization (FGISH) patterns of the recombinant chromosome 2ES ⋅ 2EL–2BL and chromosome 2E, and segregation of these two chromosomes in the self-pollinated progeny. The segment of chromosome 2B was painted in red, while chromosome 2E and its segment were painted in yellow-green. (B) Allelic segregation at the Xwgc1603 locus on chromosome 2E and 2ES ⋅ 2EL–2BL, showing molecular marker-based identification of the homozygous recombinant. “Allele_1” refers to the allele from wheat chromosome 2B (nucleotide “A”), and “Allele_2” to the allele from chromosome 2E (nucleotide “T”).

 

A subset (n = 8–10) of polymorphic SNPs locating in the distal and centromeric regions of chromosome 2B, respectively, were selected to develop PCR-based markers for recombinant detection according to the wheat 90K SNP linkage map (Wang et al., 2014). A codominant SNP without homoeoallelic interference from chromosome 2A and 2D was directly converted to a PCR-based marker. Many of the SNPs on chromosome 2B, however, were influenced by the homoeoalleles on 2A and/or 2D, leading to complicated clusters in the SNP assay. Under this circumstance, we performed comparative analysis of the DNA sequences flanking the selected SNP loci on chromosome 2B, 2A, 2D, 2S, and 2E to identify new nearby SNP loci that were polymorphic between 2B and 2S/2E, as well as between 2B/2S/2E and 2A/2D. The contextual sequences of the selected SNPs in the critical regions of chromosome 2B were used as Basic Local Alignment Seach Tool (BLAST) queries to search for extended genomic sequences flanking the SNP loci on 2B, as well as their collinear regions on chromosome 2A, 2D, 2S, and 2E, from the publicly available genome sequences of wheat, Ae. speltoides, and Th. elongatum (https://urgi.versailles.inra.fr, http://blast.ncbi.nlm.nih.gov). The newly identified SNPs were converted to PCR-based markers, which were more user friendly than the chip-based SNP assay for homoeologous recombinant detection. Three newly developed SNP-derived PCR markers (Xwgc1600, Xwgc1601, and Xwgc1602) locating in the distal region of 2BS, the centromeric region on 2BL, and the distal region of 2BL, respectively, were employed to detect the recombinants involving these three chromosomal regions (Table 2, Fig. 5A). These three markers were codominant between chromosome 2B and 2S but were dominant between 2B and 2E. They delineated the distal and centromeric regions of chromosome 2B, 2S, and 2E and two recombinant chromosomes (R1: 2SS–2BS ⋅ 2BL and R2: 2BS–2ES ⋅ 2EL). Both recombinants showed diagnostic genotypes at these three marker loci, allowing for the detection of the homoeologous recombination involving the three chromosomal regions. The marker-mediated identification of the recombinant chromosomes was consistent with their FGISH patterns (Fig. 5B). Development and application of additional SNP-derived PCR markers tagging other chromosomal regions would improve the efficacy of the markers in the recombinant detection. Therefore, properly designed chromosome region-specific molecular markers can be an effective tool for homoeologous recombination detection in alien gene introgression.


View Full Table | Close Full ViewTable 2.

Single-nucleotide polymorphism (SNP)-derived polymerase chain reaction (PCR) markers developed in this study.

 
Name Position SNP Allele-specific tailed forward primers† Reverse primer
Xwgc1600 2BS (distal end) [C/A] [Tail1]: 5′-CCAATTCAGACTGCCTATTTC-3′
[Tail2]: 5′-CCAATTCAGACTGCCTCCTAA-3′
5′-CACAGGATGATCACCACCAAGA-3′
Xwgc1601 2BL (centromeric region) [A/G] [Tail1]: 5′-ATACAACCCGTTCCCATTTA-3′
[Tail2]: 5′-ATACAACCCGTTCCCACCTG-3′
5′-TCTGATGCGGTCCAGTTAGTAAC-3′
Xwgc1602 2BL (distal end) [T/G] [Tail2]: 5′-CTGTTCATGCAATTGATTTCT-3′
[Tail1]: 5′-CTGTTCATGCAATTGATCCCG-3′
5′-GCAGCCTCTACGAATTTTCTACA-3′
Xwgc1603 2BL (distal end) [A/T] [Tail2]: 5′-GGGACGTACACTTGATTCA-3′
[Tail1]: 5′-GGGACGTACACTGGACCCT-3′
5′-ACCGCTGAACTGCTCCTCA-3′
[Tail1] = GCAACAGGAACCAGCTATGAC; [Tail2] = GACGCAAGTGAGCAGTATGAC.

The homoeologous recombinants detected by the SNP-derived PCR markers were verified and physically delineated by FGISH. The original recombinant lines normally contained a 2B–2S or 2B–2E recombinant chromosome, a complete chromosome 2S or 2E (from the substitution line parent), and 20 pairs of wheat chromosomes. They were self-pollinated to produce populations segregating for Ph1/ph1b and for 2B–2S recombinant/2S chromosome or 2B–2E recombinant/2E chromosome. The segregants homozygous for the recombinant chromosome, but without the ph1b deletion, were expected to be selected from the segregation populations using molecular markers. The segregating populations were screened first for recombinant homozygotes using the codominant SNP-derived PCR markers diagnostic for the recombination. This can be done in a high-throughput approach by measuring the fluorescence intensity in a real-time PCR machine. We successfully selected the homozygous 2ES ⋅ 2EL–2BL recombinant (R4) using the codominant SNP-derived PCR marker Xwgc1603 locating in the distal region of chromosome 2BL (Table 2, Fig. 6). Clearly, this is an effective approach for the selection of homozygous recombinants in alien gene introgression if a diagnostic codominant marker is available to tag the critical region of the recombinant chromosome. However, this type of SNP-derived PCR marker is not common in the polyploid genome of wheat. Thus, we developed SNP-derived length polymorphic PCR markers from most of the SNPs locating in the critical chromosomal regions for homoeologous recombination detection, as illustrated in Fig. 5.

The Ph1-specific molecular markers PSR128 or PSR574 have been used to check the presence of Ph1 and eliminate the ph1b deletion from the homozygotes selected above. Additional generations are generally needed to obtain homozygous recombinant lines without the ph1b deletion because the Ph1-specific molecular markers cannot differentiate individuals homozygous for Ph1 (i.e., Ph1Ph1) from hemizygotes (i.e., Ph1ph1b). Our preliminary data showed that chromosome 2S in the DS 2S(2B) line contains genes for resistance to stem rust (caused by Puccinia graminis subsp. graminis Pers.:Pers.), tan spot [caused by Pyrenophora tritici-repentis (Died.) Drechsler], and Stagonospora nodorum blotch [SNB, caused by Parastagonospora nodorum (Berk.) Quaedvlieg, Verkley, & Crous] diseases, while chromosome 2E in the DS 2E(2B) line contains genes for tolerance to waterlogging (Taeb et al., 1993). Homozygous recombinants without the ph1b deletion will be evaluated for resistance or tolerance to these biotic and abiotic stresses, as well as other agronomically important traits. The recombinant lines that contain the genes of interest, but not obvious linkage drag, will be released as germplasm for variety development in wheat breeding.


DISCUSSION

Meiotic homoeologous pairing and recombination can be enhanced by abolishing Ph1 activity but remain at a relatively low frequency in wheat (Wang et al., 1977). Accordingly, a large homoeologous recombination population is needed to recover the recombinants of interest for gene introgression from wild species into wheat. Screening such a large population for homoeologous recombinants is laborious using conventional or even modern cytological techniques, such as GISH (Friebe et al., 1991; Lukaszewski et al., 2005; Qi et al., 2007; Wulff and Moscou, 2014). Recent advances in wheat genomics, especially high-throughput genotyping technologies, have provided new opportunities to improve the efficacy of homoeologous recombination detection in alien gene introgression. In this study, we obtained genotype data for 3158 SNPs mapped to wheat chromosome 2B using the wheat 90K SNP arrays. They were polymorphic among wheat chromosome 2B, Ae. speltoides chromosome 2S, and Th. elongatum chromosome 2E. These genotype data, along with the SNP consensus map of wheat chromosome 2B (Wang et al., 2014), provided a useful genomic framework to the development of chromosomal region-specific molecular markers for the detection of meiotic recombination involving these three homoeologous chromosomes.

The multiplexed chip-based SNP assay is high throughput but may not be cost effective and user friendly for the research project involving small numbers of SNPs and a short data turnaround time (Myakishev et al., 2001; Semagn et al., 2014). For instance, in this study we needed the genotype data from the SNPs relevant to only 2B–2S and 2B–2E homoeologous pairs to detect meiotic recombination involving these three homoeologous chromosomes, but not for remaining SNPs on the 90K array. Thus, we developed the uniplex PCR-based markers from the SNPs locating in the critical chromosomal regions to detect 2B–2S and 2B–2E recombinants. The uniplex PCR-based markers are more cost effective and flexible for genotyping small numbers of SNPs than the multiplexed chip-based SNP assay. Also, the SNP-derived PCR marker technology generally has lower error rates and shorter turnaround time than the multiplexed chip-based SNP assay (Semagn et al., 2014). Evidently, the uniplex SNP-derived marker system in combination with the high-throughput multiplexed chip-based SNP assay provides an effective approach to detect homoeologous recombinants from large recombination populations.

Bread wheat is an allohexaploid with three homoeologous subgenomes (A, B, and D). Generally, there are three homoeoalleles at a majority of the molecular marker loci in wheat. Homoeoalleles in the polyploid genome of wheat often complicate marker analysis, especially for the SNP assay. This has limited the application of the fluorescence-based Kompetitive Allele Specific PCR (KASP) technique in the allopolyploid genome (Myakishev et al., 2001; Semagn et al., 2014). In this study, we used a procedure that generated length polymorphisms between the homoeoalleles of interest and differentiated them from each other based on the length polymorphisms and fluorescence labels (Qi et al., 2015; Long et al., 2016). The PCR-based markers developed from the diagnostic SNPs locating in the distal ends and centromeric region of chromosome 2B were successfully used to detect the 2B–2S and 2B–2E recombination involving those chromosomal regions. Additional PCR-based markers can be developed from the SNPs spanning other chromosomal regions for the detection of the homoeologous recombination potentially along the entire chromosomes. This new procedure extends the application of SNPs in marker-assisted selection and improves the efficacy of SNPs in the detection of meiotic homoeologous recombination for alien gene introgression in the polyploid genome of wheat.

The wheat 90K SNP arrays were developed primarily from the transcriptomes of modern wheat accessions. Wild relatives of wheat, such as Ae. speltoides and Th. elongatum, were not included in the wheat SNP discovery process (Wang et al., 2014). As a result, Ae. speltoides chromosome 2S and Th. elongatum chromosome 2E often exhibited null alleles at some of the wheat chromosome 2B-derived SNP loci. Those dominant SNPs cannot be used to detect the alien segments tagged by the null alleles under the heterozygous condition with the presence of the dominant alleles on wheat chromosome 2B. To overcome this problem associated with those dominant SNPs, we recovered the homoeologous recombinant gametes by backcrossing the individuals that underwent meiotic 2B–2S and 2B–2E recombination to the disomic substitution lines DS 2S(2B) and DS 2E(2B), respectively. This allowed the use of dominant markers to detect the null allele present on the alien segment of the recombinant in the presence of the respective alien chromosome (i.e., 2S or 2E) and absence of wheat chromosome 2B. In addition, the alien chromosomes 2S and 2E introduced into the recombinant recovery populations served as positive controls for GISH analysis of the recombinants, especially for those with small alien segments. Therefore, this backcross strategy makes the dominant markers with null alleles on the alien segments usable in the detection of homoeologous recombination and facilitates GISH analysis of the recombinants as well.

Generally, the ph1b mutant can induce allosyndetic pairing and recombination between wheat chromosomes and their alien homoeologues, as well as autosyndetic pairing and recombination between wheat homoeologues from the A, B, and D subgenomes (Cai and Jones, 1997). We observed multivalents involving multiple wheat chromosomes in addition to 2B–2S or 2B–2E bivalents under the homozygous ph1b condition (data not shown). Thus, the ph1b mutant-generated gametes with an allosyndetic recombinant may contain one or more autosyndetic recombinants. These gametes are generally less competitive in pollination and fertilization than those without homoeologous recombinants, especially in the male parent. As a result, this may limit the recovery of allosyndetic recombinants, especially by self-pollination of the individuals undergoing allosyndetic pairing and recombination. In this study, we recovered the recombinant gametes by pollinating the individuals undergoing 2B–2S and 2B–2E homoeologous pairing and recombination with the disomic substitution lines DS 2S(2B) and DS 2E(2B), respectively. These two disomic substitution lines went through normal meiosis and had a normal seed set similar to the CS wheat parent. In a preliminary study, we observed a higher homoeologous recombinant frequency in the backcross progeny than in self-pollinated progeny. Similarly, a high recovery rate of meiotic homoeologous recombinants was obtained from the backcross progeny in an alien introgression study by Niu et al. (2011). Thus, the backcross scheme with the disomic substitution lines can enhance the recovery of homoeologous recombinants, in addition to facilitating the detection of homoeologous recombinants.

In summary, we developed an effective DNA marker-assisted approach of inducing and detecting meiotic homoeologous recombination in the polyploid genome of wheat using the genomics technologies and resources currently available in wheat. This new approach will facilitate largescale alien gene introgression for wheat improvement and ultimately increase the genetic gain of wheat production.

Conflict of Interest

The authors declare there to be no conflict of interest.

Acknowledgments

We thank members of the labs involved for their help in this research and Drs. Lili Qi and Rebekah Oliver for critical review of the manuscript. This project is supported by Agriculture and Food Research Initiative Competitive Grant no. 2013-67013-21121 from the USDA National Institute of Food and Agriculture and the wheat research grant from the North Dakota Wheat Commission.

 

References

Footnotes


Comments
Be the first to comment.



Please log in to post a comment.
*Society members, certified professionals, and authors are permitted to comment.