View Full Table | Close Full ViewTable 1.

Summary of criteria used for gene functional classification.

 
Category Subcategories Examples
Cell wall – Cellullose: synthesis/degradation Cyclin and cyclin-like, cell division control proteins, beta-glucanase, xylan 1,4-beta-xylosidase, cellulose synthase, PMEs PGAs, PRP, HRGPs, UDP-sugar synthesis.
– Hemicellullose: synthesis/degradation
– Pectins: synthesis/degradation
– Callose synthesis/degradation
– Structural proteins
– Other misc. enzymes
Cytoskeleton – Actin
– Kinesin
– Microtubule-related
Defense – Apoptosis Apoptosis regulators, apoptosis inhibitors, beta-1,3-glucanase, chitinase, thaumatin, defensin, SNAKIN, Pto interacting, disease resistante with LRR domains.
– PR proteins
– R proteins
DNA/RNA – DNA processing Helix-loop-helix domains, most types of zinc fingers, histones, polymerases, helicases, others transcription factors, components of splicesome, capping enzymes and poly (A) polymerase.
– RNA processing
– Gene regulation
– Nuclear organization
Energy – ATP ATPases
– Electron transfer Ferredoxins photosystems subunits, RUBISCO subunits, DAG protein, cytocromes
– Photosynthesis
Lipids – Fatty Acid biosynthesis, degradation, utilization HMG-CoA synthase, acetylCoA-Carboxylase
– Eicosanoids and isoprenoids biosynthesis, utilization and degradation
Membrane – Integral to membrane (structural) Aquaporins, ABC transporters, ion channels, sugar transporters nitrate transporters, Chlathrin. TIM and TOM.
– Transport
– Vesicle mediated transport
Miscellaneous – Do not fit into any of the mentioned categories Cytochrome P450, Ankyrin, Anexin
– Several possible functions.
– Chimeric
– Different annotations across databases
No hits No significant homology with any record on the databases. (E-value greater than 10−7 or percentage of similarity less than 13%)
Oxidation – Catalses
– GST
– Oxidases
– Oxidoreductases
– Peroxidases
– SODC
Primary metabolism – Amino Acids metabolism
– Carbohydrates metabolism
– Nucleosides and nucleotides metabolism
– Vitamins / Cofactors metabolism
Protein – Degradation and Inhibition of Degradation Proteasome subunits, ubiquitin, metalloproteases, serine proteases, ubiquitin ligase, protease inhibitors, chaperones, heat sock proteins, ribosome subunits.
– Folding (include all chaperones and cyclophylins)
– Localization
– Modification (Includ all additions of small and large groups: methylation, acetylation, phosphorylation, glycosylation, lipidation, prenylation).Except ubiquitination which is classified as a degradation process.
– Synthesis
Secondary metabolism – Alkaloid biosynthesis CHS/CHR, IFS, IFR, F3H, FLS, DFR, HID, COMT, 4CL CCoAOMT, F5H, CAD/SAD.
– General Phenylpropanoid pathway
– Flavonoid biosynthesis HMG-CoA, mevalonate kinase, Farnesyl PP synthase, Geranylgeranyl PP synthase
– Lignin biosynthesis
– Isoprenoid pathway (mevalonate pathway derived and non-mevalonate pathway) including: Terpenes, sesquiterpenes, diterpenes, polyprenols. Excludes the ones that can be classified as hormones and primary metabolites.
Senescence Known to be directly related with senescence SRG1
Signalling – Calcium Signalling EF hands domains, calmodulin, monomeric G proteins, heterotrimeric G proteins, ERF, myo-inositol-phosphate synthase, Ser/Thr kinase, MAP kinases
– G proteins
– Hormones. (ABA, auxins, ethylene, citokinin, giberelic acid; involved in the synthesis of the molecules or in their respective signalling events)
– Inositol (involved in the signalling pathway or only in the biosynthesis of inositol are included)
– Kinases that are not specific or are not known to any of the signalling pathways mentioned.
– Phosphatases that are not specific or are not known to any of the signalling pathways mentioned.
– Receptors /sensors
Stress Any protein known to be involved in stress responses in plants that don't fit in any of the signalling groups. Dehydrin, ERD3, SALI3, SLT1
Unknown – Matched and hypothetical gene or domain
– Expressed but of unknown function



View Full Table | Close Full ViewTable 2.

Primers used for qRT-PCR.

 
Microarray clone ID Annotation Study Forward primer Reverse primer
Gm-r1089-8081 chloroplast membrane genot gcatgtgctttcctgctcct cagatcgacggcccagaat
Gm-r1021-3690 Csf-2 genot ggtaggcaccaatttctttgctc aggaaaagggaagcgttgtg
Gm-r1088-2632 CYP82A3 genot tggagtagccttggtgttgg ccctttggaagtgggagaag
Gm-r1083-1013 homolog to R gene genot tggaacaccaaaccaaacc tggcattgtgagaggctagag
Gm-r1070-5331 SF21C2 protein genot acaagccaccgcttatcacg gtggagcagcaatgaacagg
Gm-r1089-3849 transcription factor genot aaaggggtgttctcattgtcc gagggaactatacccagaaggaag
Gm-r1083-517 unknown genot ccataacaccaacagcaccac ccaaaagggataaggggtaggac
Gm-r1070-2321 β-1,3-glucanase time tgctgtgaaaagagcataggg ttccttcaggggtgatgtgag
Gm-r1089-4085 class I chitinase time ggccaccgttgattatgttg gacagccctatggttttggatg
Gm-r1088-8177 metalloproteinase time atgcgagtttggcagcagag tcacagtcagagcaacgaaagg
Gm-r1088-8829 PR-1 time tgacacagttgcggcttttg tccccgtattttccatcacc
Gm-r1089-8255 class I chitinase time ggccaccgttgattatgttg gacagccctatggttttggatg
Gm-r1089-8595 unknown time gcacctttcgttgctctgac gacttggagactgtggcgatg
Gm-c1026-2067 CDPK-related kinase cons15 taaagagcaccatgcctatcc tggttatgtgagcagatgcaa
Constitutive control used for data normalization (Libault et al., 2008).



View Full Table | Close Full ViewTable 3.

Cell wall-related genes with differential regulation in time-course analysis (14 vs. 8 hpi).

 
Microarray clone ID Fold change p-value Fold change p-value Sub category Annotation
Gm-r1021-1490 –0.362 0.025 –0.228 0.130 Cell adhesion beta-Ig-H3/fasciclin-Arabinogalactand protein
Gm-r1083-3766 –0.671 0.033 –0.436 0.140 Cell adhesion fasciclin-like arabinogalactan-protein 2
Gm-r1021-2754 –0.694 0.027 –0.619 0.062 Cell adhesion fasciclin-like arabinogalactan-protein 7
Gm-r1070-7235 0.830 0.027 0.548 0.123 Callose callose synthase
Gm-r1089-4947 –1.144 0.028 –0.692 0.140 Cellulose biosynthesis/ cellullose synthase
Gm-r1083-683 –0.826 0.023 –0.732 0.059 Cellulose degradation/ Endo-1,4-beta-glucanase
Gm-r1070-2226 –0.552 0.037 –0.429 0.110 Cellulose biosynthesis/ cellulose synthase catalytic chain
Gm-r1089-3965 –0.548 0.044 –0.690 0.031 Cellulose degradation/ Endo-1,4-beta-glucanase
Gm-r1021-1934 1.493 0.020 1.175 0.069 Cellullose biosynthesis/ UDP-glucose:protein transglucosylase
Gm-r1089-396 –1.162 0.005 –0.445 0.104 Hemicellullose xyloglucan endotransglycosylase
Gm-r1088-8463 –0.591 0.034 –0.430 0.101 Hemicellullose xyloglucan endotransglycosylase
Gm-r1088-4246 –1.515 0.012 –1.089 0.050 Hemicellullose xyloglucan endotransglycosylase
Gm-r1070-6513 –0.894 0.023 –0.435 0.200 Pectin pectin methylesterase
Gm-r1070-5102 –0.809 0.007 –0.424 0.077 Pectin pectin methylesterase
Gm-r1089-298 –0.528 0.021 –0.415 0.059 Pectin polygalacturonase
Gm-r1083-188 –0.491 0.015 –0.336 0.075 Pectin nucleotide sugar epimerase-like protein
Gm-r1088-5667 0.333 0.061 0.431 0.039 Pectin peptidoglycan biosynthesis
Gm-r1083-3987 1.109 0.046 1.000 0.093 Pectin pectinesterase
Gm-r1021-3627 1.897 0.008 1.633 0.031 Pectin polygalacturonase inhibiting protein
Gm-r1088-1103 –0.762 0.018 –0.401 0.145 Structural proteins expansin
Gm-r1088-3031 1.089 0.027 0.692 0.121 Structural proteins expansin
Gm-r1088-5190 1.201 0.006 0.575 0.067 Structural proteins expansin
Gm-r1021-2732 1.293 0.038 1.326 0.060 Structural proteins expansin
Gm-r1089-3338 1.500 0.038 0.920 0.167 Structural proteins expansin
Gm-r1088-5055 1.572 0.014 0.447 0.366 Structural proteins expansin
Gm-r1089-8201 1.797 0.043 1.479 0.089 Structural proteins expansin
Gm-r1089-8696 2.431 0.021 2.634 0.028 Structural proteins expansin
Gm-r1070-4170 –1.617 0.005 –1.395 0.022 Structural proteins glycine-rich protein precursor (GRP)
Gm-r1070-571 –1.001 0.028 –0.822 0.077 Structural proteins proline-rich protein
Gm-r1021-3212 –0.571 0.023 –0.536 0.053 Structural proteins hydroxy-proline rich glycoprotein (HPRG)
Fold change expressed as log2 of the 14:8 hpi intensity ratio.
FDR corrected p-value.



View Full Table | Close Full ViewTable 4.

Ethylene biosynthesis and ethylene-related factors changing in expression at 14 vs. 8 hpi.

 
Microarray clone ID Williams 82 (S) PI 194.639 (S) Annotation
Fold change p-value Fold change p-value
Gm-r1088-4339 1.089 0.033 0.908 0.068 EIN3-binding F-box protein 1
Gm-r1021-4003 0.754 0.016 0.690 0.046 ERF / APETALA related
Gm-r1089-8513 1.900 0.017 1.948 0.028 Ethylene response factor ERF1
Gm-r1083-4514 0.821 0.037 0.675 0.095 Ethylene response sensor
Gm-r1083-2406 0.165 0.064 0.252 0.042 Ethylene transcription factor
Gm-r1070-903 0.727 0.030 0.643 0.070 Ethylene-responsive element binding factor
Gm-r1088-5816 1.037 0.017 0.670 0.083 ACC-oxidase
Gm-r1021-612 1.755 0.015 1.038 0.103 ACC-oxidase
Gm-r1021-2425 0.266 0.191 0.763 0.031 ACC-oxidase
Gm-r1083-4527 2.122 0.017 1.714 0.058 Beta-cyanoalanine synthase
Fold change expressed as log2 of the 14:8 hpi intensity ratio.
FDR corrected p-value.



View Full Table | Close Full ViewTable 5.

S. sclerotiorum transcripts with high probability of cross-hybridization with soybean cDNAs present in the microarrays.

 
Microarray clone ID Study Soybean annotation S. sclerotiorum annotation e-value Length of hit Match
%
Gm-r1083-1968 time stress-induced gene conserved hypothetical protein 6.00E-51 117 96.50
Gm-r1070-4163 time actin actin 2.00E-36 281 81.80
Gm-r1088-3643 time beta tubulin betatubulin 2.00E-30 139 87.00
Gm-r1070-7495 time beta tubulin beta tubulin 6.00E-29 140 86.40
Gm-r1070-894 time actin-like actin 7.00E-24 152 84.20
Gm-r1089-3867 time 40S ribosomal protein S19 40S ribosomal protein S20 2.00E-22 380 79.00
Gm-r1070-7963 time beta tubulin beta tubulin 5.00E-19 131 83.90
Gm-r1088-4542 time beta tubulin beta tubulin 7.00E-19 95 87.30
Gm-r1070-4376 time calmodulin calmodulin 5.00E-14 227 79.20
Gm-r1089-3621 time DNA polymerase delta subunit hypothetical protein 2.00E-13 119 83.10
Gm-r1070-4556 time histoneH2 histoneH3 6.00E-13 113 83.10
Gm-r1070-7963 time beta tubulin beta tubulin 7.00E-12 83 85.50
Gm-r1083-2517 time unknown protein glyceraldehyde-3-phosphatedehydrogenase 2.00E-11 35 100.00
Gm-r1021-3330 time 40S ribosomal protein S11 conserved hypothetical protein 7.00E-10 72 86.10
Gm-r1070-7630 time heat shock 70kDa protein heat shock 70kDa protein 2.00E-09 140 80.70
Gm-r1083-4132 genot ADP-ribosylation factor 1 ADP-ribosylation factor 1 2.00E-09 87 83.90
Gm-r1021-1771 time heat shock 70kDa protein heat shock 70kDa protein 6.00E-09 123 81.30



View Full Table | Close Full ViewTable 6.

Positions of SSR markers for resistance to S. sclerotiorum in soybean compared to positions of cDNAs with differential abundance (FDR p<0.05) in the microarray study. cDNAs mapping <500 kbp away from markers are shown.

 
Marker: Satt_109; LG: O; scaffold_52; position 3367602–3367834
Clone ID cDNA position Distance to marker Study Annotation
cDNAs <500kbp away: Gm-r1083-4362 3152671--3152887 215 time endopeptidase
Gm-r1083-2561 3817705--3818094 450 time nitrate transporter
Gm-r1021-683 3849345--3849897 482 time putative hydrolase
Gm-r1021-3489 3850178--3850448 482 time putative hydrolase
Marker: Satt243; LG: O; scaffold_52; position 4921005–4921142
Clone ID cDNA position Distance to marker Study Annotation
cDNAs <500kbp away: Gm-r1070-5470 4473957--4474424 446 time RNA polymerase II
Gm-r1088-3248 4634104--4634386 286 time phosphoglucomutase
Gm-r1070-4196 4910296--4911097 10 time homeodomain-related
Gm-r1070-6363 5042383--5042773 121 time elicitor receptor
Gm-r1088-3643 5126743--5127893 205 time beta tubulin
Marker: Satt129; LG: D1a; scaffold_13; position 9484939–9485271
Clone ID cDNA position Distance to marker Study Annotation
cDNAs <500kbp away: Gm-r1088-8424 8905396--8905547 580 time phospholipase D-γ
Gm-r1083-4184 9104547--9105266 380 time PR-5
Gm-r1021-3935 9108461--9108843 376 time PR-5
Gm-r1083-1040 9108592--9108964 375 time PR-5
Gm-r1083-4829 9265037--9265394 219 time calcium-binding EF-hand
Gm-r1088-2660 9276566--9277069 207 time transcription factor
Gm-r1089-3625 9783919--9784565 298 time phosphatidylinositol kinase
Marker: Satt147; LG: D1a; scaffold_13; position 9150940–9151134
Clone ID cDNA position Distance to marker Study Annotation
cDNAs <500kbp away: Gm-r1088-820 8852510--8853241 298 genot anthocyanidin synthase
Gm-r1088-8424 8905396--8905547 245 time phospholipase D-γ
Gm-r1083-4184 9105294--9105550 45 time PR-5
Gm-r1021-3935 9108461--9108843 42 time PR-5
Gm-r1083-1040 9108592--9108964 42 time PR-5
Gm-r1083-4829 9265037--9265394 113 time calcium-binding EF-hand
Gm-r1088-2660 9276566--9277069 125 time transcription factor
Marker: Satt424; LG: A2; scaffold_22; position 2084752–2085179
Clone ID cDNA position Distance to marker Study Annotation
cDNAs <500kbp away: Gm-r1070-470 2122392--2122734 37 time myo-Inositol-1-P-synthase
Gm-r1070-470 2122392--2122734 37 genot myo-Inositol-1-P-synthase
Gm-r1089-7372 2504130--2504705 418 time no hits
Distance kilo base pairs.
Studies: conducted between R vs. S (genot) or 14 vs. 8 hpi (time).