View Full Table | Close Full ViewTable 1.

PCG EST–SSR primer list. Results in normal text indicate alignment to maize and in bold, italic text indicate alignment to sorghum.

 
Contig SSR Motif Estimated size Polymorphic Annealing temperature Primer BLAST results <e−20
bp °C
00687 (TC)7 184 yes 55 F GCCTTCTCATCCTTCTTGG endothelial differentiation-related factor 1 (EU961228)
R AGAGTCAGCGAGCGAGAA
01896 (AG)9 172 no 55 F TGCAGTGTCATGTGACTTTT metal ion binding protein (EU958179)
R ACAGGCTGCTCTACCTAACA similar to Heavy metal-associated domain containing protein
02282 (GCC)6 231 no 55 F TGGAACTCGTACATCAAGAA P-type R2R3 Myb protein (AF470079)
R CATGTCGTTGTAGCTTTCAG similar to Myb factor
04363 (CAT)5 169 yes 55 F TCAACACCTTCTCTGTCTCC dnaJ domain containing protein (NM_001154772)
R CAGCTCGTACAGGTCGTAG similar to H0103C06.7 protein
04382 (CTG)5 163 yes 55 F CTGCCGCAACTTACAAAG
R CGGAGTTCATCGACTTCTT similar to No apical meristem protein, expressed
06305 (TA)6 171 yes 55 F GCAGCAACAATACATGAAGA Zea mays nicotinate phosphoribosyltransferase-like protein (NM_001159021)
R ACTGAAGTCTCCGCATGA similar to OSJNBa0042L16.16 protein
06349 (CT)8 191 yes 55 F GGTGATCTGATCTTGCTGTT cytokinin dehydrogenase 10 (NM_001153366)
R CATTACAGCTTTCGTTTTCC
07313 (GT)7 155 yes 55 F CATTTCCTGGTGCATTATTA 60S ribosomal protein L37 (NM_001155742)
R CCCACAACATACAACACAAC
08011 (GCG)3 101 yes 55 F GCTCAACGCCTACTTCAA
R AACCAGTTGGTGTTGCTCT
08942 (CGC)5 172 no 55 F GTACAAAAGCGTTGAGCAC
R CTCCATAAATTCCGGGTAG similar to Oxidoreductase, 2OG-Fe oxygenase family protein
09063 (CGG)5 184 yes 55 F TCTTGGTGCTCTTGCAGTA dihydroflavonol-4-reductase (NM_001158455)
R GAGATCATCGAGCCCATC similar to Putative cinnamoyl-CoA reductase
12386 (GCG)5 185 yes 55 F GAATTTTGTGATCGCAGTG
R GCTCTTGTACTCCCTCTCCT similar to Putative RNA-binding protein
15096 (TTC)5 168 no 55 F CGATAAGACTTGCCTTCTTT
R ATGTCGAGGAAGAGGAAGA similar to Putative uncharacterized protein P0461D06.29
16063 (CCG)5 267 yes 55 F GAACAGATTCTTGGGATCAA
R TCCTGCTCCTGTAAGTTCAC similar to Protein kinase domain containing protein
16764 (CAG)5 171 yes 55 F CGGTACCGGAAGAAGAGA
R CTTGAGCACCACCTCCTT
16969 (GCG)5 232 no 55 F GACCGTGGCAGAGGTCTT
R AGGTCAAGCACTCGTTCAAG similar to Histone H1-like protein
17168 (CAC)6 325 no 55 F AAGTTCAGCCCTTGGAAC
R TAGGACCAGGTGAGAAAAGA
17692 (CGG)5 223 yes 55 F CTTGTACTCCCTGTCGAAGA
R AGTTACTGAAAAGCCAGCAG
17800 (TCG)5 184 no 55 F CTCAGGTCCACGAGGTAGT
R TGTCGTACAACTCGCTGTC similar to Polygalacturonase inhibiting protein-like
17943 (CCG)5 212 no 55 F GCTACGTCAGCCTCTACAAG
R CGAGTAGCTGTCCACCAC similar to Os05g0120300 protein
19261 (GCA)5 270 yes 55 F CATCGTAGGCTCAAGAAGG
R CTGATCCGAGCTGAACTG similar to Associated with HOX family protein, expressed
20737 (GTC)6…(CTT)5 328 yes 55 F TCCTCCTCATCACTTTCAAC
R ACGAGGTGAAGCTCAACA
20797 (CCG)4…(GAT)5 550 yes 55 F TCCCTCCTGAGTCTACTCCT transcription factor BTF3 (EU956752)
R CTCTTCAAACGTCTCTCCAG
21380 (TGA)5 179 yes 55 F ATCAGGAGTGACTTTGATGC
R AAGTCCTCAACACCATCATC similar to Acidic leucine-rich nuclear phosphoprotein 32-related protein 1
21486 (CTC)6 199 yes 55 F CGGAGAAGAAGTTGGAGAG
R GTTTTGGAGAGGGTGGAA
22367 (GA)7 231 yes 55 F GGAAGGAAGGAGACGAAC polyphosphoinositide binding protein Ssh2p (EU966771)
R TGACGTACTTCACCAGCAT similar to Putative phosphatidylinositol/phosphatidylcholine transfer protein
24500 (CA)9 168 no 55 F ACCCTGGAGTCACAAATAAA autophagy-related 4 (Atg4a) (NM_001144016)
R GGTTAAGAACGATGACCTTG similar to Cysteine protease ATG4B
25164 (TC)9 173 yes 55 F GCGAACAGGTACAGAAACAC membrane protein (NM_001155277)
R AGCAAGTTCAACCACGTCT similar to Auxin-induced protein-like
25201 (GAA)5 175 yes 55 F GGAACTACAACAAGGAGCAT
R TTGTAGCAGGGCTCTATACC similar to Digalactosyldiacylglycerol synthase 1, putative, expressed
25412 (ATG)5 165 yes 55 F AGCAGTACCAGGGAAGCTAT pro-resilin precursor (EU959970)
R ATTCAGTGGTGGAACAAGAC



View Full Table | Close Full ViewTable 2.

Top ten contigs determined by depth of coverage (No. reads) and their respective alignments.

 
Contig Length (bp) No. reads BLASTx Result
22512 805 1704 Extracellular ribonuclease (Z. mays)
18270 1001 730 MADS-box transcription factor (T. aestivum)
25744 718 680 Auxin-induced protein (Z. mays)
16722 960 674 Nucleotide pyrophosphatase (O. sativa)
23305 376 659 Granule-bound starch synthase pseudogene (Z. mays)
18651 367 637 Hypothetical protein
26205 446 636 Hypothetical protein
23588 1488 606 Alcohol dehydrogenase (O. sativa)
24174 868 596 Hypothetical protein
16576 182 580 Hypothetical protein



View Full Table | Close Full ViewTable 3.

Alignment of PCG contigs to other databases from closely related and non-related species. Significance level at E-value <e−20.

 
Database Contigs which aligned significantly Total number of contigs
NCBI non-redundant 12,498 17,221
Poaceae 12,487 17,541
Sorghum bicolor 12,690 17,506
Zea mays 10,782 15,486
Saccharum officinarum 522 1119
Panicum virgatum 15 31



View Full Table | Close Full ViewTable 4.

Contigs containing di- and trinucleotide EST–SSR regions longer than 15 bp and their respective alignment to other grass species.

 
Contig Rice Sorghum Maize Wheat Barley Bamboo Other Contains SSR SSR motif
contig00099 No significant alignments
contig00531 yes GAC/CTG, TGA/ACT
contig01896 Panicum virgatum
contig02142 yes GCT/CGA
contig02282 yes GCC/CGG
contig02286
contig02898 yes ACC/TGG
contig03228 yes GAC/CTG
contig03778 Puccinellia tenuiflora
contig03847 yes AGA/TCT
contig03850
contig03870 yes AGC/TCG
contig03953 yes TCC/AGG
contig06349
contig07196 yes CCG/GGC
contig08102 yes AAC/TTG
contig08322 yes CAG/GTC
contig08938 yes CGG/GCC
contig09510 Eragrostis tef
contig09517 No significant alignments
contig09843 Lolium perenne yes GCA/CGT
contig11685 yes CTT/GAA
contig12311 No significant alignments
contig16180 No significant alignments
contig16969
contig17168 yes CAC/GTG
contig18725 yes TCA/AGT
contig18766 yes GGC/CCG
contig18981 yes GGC/CCG, CAG/GTC
contig19448 Saccharum officinarum yes GCG/CGC
contig19955 yes GCT/CGA
contig20041 yes TCA/AGT
contig20426 yes GCG/CGC
contig20475
contig20737 yes GTC/CAG
contig21486 yes CTC/GAG
contig21657
contig22231 No significant alignments
contig23465 No significant alignments
contig23487 yes TC/AG
contig23868 yes CTT/GAA
contig24011
contig24500
contig25016 yes GTT/CAA
contig25164
contig25371
contig25633 yes TC/AG
Phyllostachys edulis (Carrière) J.Houz. and Dendrocalamus latiflorus Munro.
ePCR amplification to rice sequence NM_001049469.
§ePCR amplification to rice sequence NM_001056341 & NM_001061810.
ePCR amplification to rice sequence NM_001068592.



View Full Table | Close Full ViewTable 5.

Lignin biosynthetic pathway enzymes identified from the annotation of the PCG transcriptome.

 
S. bicolor Z. mays Poaceae S. officinarum
COMT 0 1 1 2
CCoAOMT 5 4 1 0
C4H 0 0 1 0
PAL 4 2 3 6
CAD 3 1 3 10
C4L 29 4 5 0
CCR 4 0 4 0



View Full Table | Close Full ViewTable 6.

Length of contigs found to align to enzymes Caffeic acid 3-O-methyltransferase (COMT) and Caffeoyl-CoA 3-O-methyltransferase (CCoAOMT).

 
Contig Annotation Enzyme Length (bp) Translated length (aa)
03448 S. officinarum COMT 613 122
04815 S. bicolor, Z. mays CCoAOMT 942 229
06137 S. bicolor, Z. mays CCoAOMT 558 170
06523 S. bicolor, Z. mays CCoAOMT 334 76
13867 Z. mays, Poaceae COMT 259 69
16262 S. officinarum COMT 1192 224
18666 S. bicolor, Z. mays CCoAOMT 192 N/A
21502 S. bicolor, Poaceae CCoAOMT 998 260



View Full Table | Close Full ViewTable 7.

Accessions used to perform phylogenetic analysis with the contigs identified as being the enzymes COMT and CCoAOMT.

 
Designation NCBI Accession Species Phylogentic group
1 CAJ26379 Brachypodium sp. 5
2 AAP37878 Z. mays 4
3 AAP37879 4
4 AAP37881 4
5 AAP37882 4
6 AAP37884 4
7 AAP37885 4
8 AAQ24337 3
9 AAQ24338 3
10 AAQ24339 3
11 AAQ24342 3
12 AAQ24343 3
13 AAQ24344 3
14 AAQ24361 3
15 AAQ89900 4
16 ACG33694 1
17 ACG36166 5
18 ACG37598 3
19 ACG47259 2
20 ACN35776 1
21 NP_001106047 3
22 NP_001132142 2
23 NP_001140567 1
24 NP_001140761 1
25 NP_001148593 1
26 NP_001150570 7
27 NP_001150654 2
28 NP_001151485 4
29 NP_001152451 6
30 NP_001152511 6
31 Q06509 3
32 Q9XGD5 4
33 BAD14923 O. sativa 3
34 EAY80724 2
35 EAY99818 4
36 EAZ05653 3
37 EAZ09516 5
38 EAZ20379 1
39 EAZ41571 3
40 EAZ43214 6
41 EEE64356 1
42 NP_001056039 1
43 NP_001056040 1
44 NP_001056910 4
45 NP_001061012 7
46 NP_001061031 3
47 NP_001062142 6
48 NP_001062144 outlier
49 NP_001063495 5
50 NP_001067748 2
51 NP_001067749 2
52 AAL57301 S. bicolor 3
53 AAO43609 3
54 XP_002436550 4
55 XP_002441374 1
56 XP_002441379 1
57 XP_002444017 1
58 XP_002444595.1 1
59 XP_002444815 outlier
60 XP_002444818 6
61 XP_002445083 3
62 XP_002450036 2
63 XP_002450037 2
64 XP_002450658 2
65 XP_002462549 5
66 CAJ19350 T. aestivum 5
67 CAP72304 2