About Us | Help Videos | Contact Us | Subscriptions
 

The Plant Genome - Article

 

 

This article in TPG

  1. Vol. 3 No. 3, p. 179-189
    OPEN ACCESS
     
    Received: July 27, 2010


 View
 Download
 Alerts
 Permissions
 Share

doi:10.3835/plantgenome2010.07.0017

Marker Development and Saturation Mapping of the Tan Spot Ptr ToxB Sensitivity Locus Tsc2 in Hexaploid Wheat

  1. Nilwala S. Abeysekara,
  2. Timothy L. Friesen,
  3. Zhaohui Liu,
  4. Phillip E. McClean and
  5. Justin D. Faris 
  1. N.S. Abeysekara and P.E. McClean, Dep. of Plant Sci., North Dakota State Univ., Fargo, ND 58102; T.L. Friesen and J.D. Faris, USDA-ARS Cereal Crops Research Unit, Northern Crop Sci. Lab., 1307 18th St. N., Fargo, ND 58102-2765; Z.H. Liu, Dep. of Plant Pathology, North Dakota State Univ., Fargo, ND 58102

Abstract

Ptr ToxB is a host-selective toxin produced by the tan spot fungus, Pyrenophora tritici-repentis, that induces chlorosis in wheat lines harboring the Tsc2 gene, which was previously mapped to chromosome arm 2BS in tetraploid wheat (Triticum turgidum L.). In this study, molecular mapping in a recombinant inbred line (RIL) population derived from the Ptr ToxB-sensitive ‘Katepwa’ and the Ptr ToxB-insensitive landrace Salamouni (Salamouni × Katepwa [SK] population) confirmed the location of Tsc2 on 2BS in hexaploid wheat (Triticum aestivum L.). Analysis of an F2 population derived from the same parents indicated that a single dominant gene governed Ptr ToxB sensitivity. Thirteen microsatellite markers were used to construct a basic linkage map of the Tsc2 region in the SK population, and 14 additional markers developed from bin-mapped expressed sequence tags (ESTs) and from ESTs identified based on colinearity with rice (Oryza sativa L.) and Brachypodium distachyon (L.) P. Beauv. were mapped to the Tsc2 region. Tsc2 was delineated to a 3.3 cM interval and cosegregated with marker XBE444541. Spore inoculations and composite interval-regression mapping demonstrated that a compatible Tsc2-Ptr ToxB interaction accounted for 54% of the variation in disease expression. Analysis of Ptr ToxB-sensitive and-insensitive genotypes suggested that XBE444541 is diagnostic for Tsc2 and should be useful for marker-assisted selection.


Abbreviations

    cDNA, complementary DNA; DFCI, Dana Farber Cancer Institute; EST, expressed sequence tag; HST, host-selective toxin; ITMI, International Triticeae Mapping Initiative; LOD, logarithm of odds; MAS, marker-assisted selection; NCBI, National Center for Biotechnology Information; NSF, National Science Foundation; PCR, polymerase chain reaction; QTL, quantitative trait loci; RFLP, restriction fragment length polymorphism; RIL, recombinant inbred line; SK, Salamouni × Katepwa; SSD, single seed descent; SSR, simple sequence repeat; TC, tentative consensus; STS, sequence-tagged site

Many foliar diseases, such as tan spot (also known as yellow spot) of wheat (Triticum aestivum L.) caused by Pyrenophora tritici-repentis, result in major yield losses throughout the world, and some are caused by fungi that produce host-selective toxins (HSTs). Host-selective toxins produced by necrotrophic fungal pathogens behave as effectors to induce disease susceptibility in hosts harboring genes that mediate effector recognition. The ascomycete fungus Pyrenophora tritici-repentis (Died.) Drechs., anamorph Dreschslera tritici-repentis (Died.) Shoem., is a necrotroph that causes tan spot in wheat, and it produces several HSTs (Lamari et al., 2003) including Ptr ToxA, Ptr ToxB, Ptr ToxC, and several other partially characterized toxins including two named as Ptr ToxD (Tomás and Bockus, 1987; Tuori et al., 1995; Orolaza et al., 1995; Effertz et al., 2002; Ciuffetti et al., 1998, 2003; Meinhardt et al., 2003; Ali and Francl, 2002).

Ptr ToxA is a 13.2 kDa proteinaceous HST that causes necrosis in sensitive wheat genotypes and is produced by P. tritici-repentis races 1, 2, 7, and 8 (Zhang et al., 1997; Lamari et al., 2003). The wheat Tsn1 gene, which maps to the long arm of wheat chromosome 5B, confers sensitivity to Ptr ToxA (Faris et al., 1996). Fine mapping of the Tsn1 locus (Haen et al., 2004; Lu and Faris 2006; Lu et al., 2006) and bacterial artificial chromosome (BAC)-based physical mapping led to the cloning of Tsn1 (Faris et al., 2010). Tsn1 encodes a protein harboring resistance gene-like features including serine or threonine protein kinase, nucleotide binding (NB), and leucine-rich repeat (LRR) domains.

Ptr ToxC is a nonionic, polar, low molecular mass molecule that, like Ptr ToxB, causes chlorosis but on host genotypes harboring the Tsc1 gene residing on the short arm of wheat chromosome 1A (Effertz et al., 2002; Strelkov and Lamari, 2003). Unlike Ptr ToxA and Ptr ToxB, Ptr ToxC is nonproteinaceous and is produced by races 3, 6, and 8 (Strelkov and Lamari, 2003).

Ptr ToxB is produced by P. tritici-repentis races 5, 6, 7, and 8 and is a 6.61 KDa proteinaceous HST (Lamari et al., 2003; Strelkov et al., 1999) that induces chlorosis in sensitive wheat genotypes. ToxB is a complex locus comprised of a 261 bp open reading frame (ORF). It has been cloned and found to be a multicopy gene, in comparison to the single-copy ToxA gene (Martinez et al., 2001). There is sequence variability of the ToxB gene among P. tritici-repentis races and homologs of the ToxB gene have been identified from nonpathogenic isolates that do not produce Ptr ToxB (Martinez et al., 2004; Strelkov et al., 2006). ToxB homologs have also been found in Pyrenophora bromi (Died.) Drechsler, and other members of the Ascomycota, suggesting an origin in early ancestors of the Ascomycota (Andrie et al., 2008). However the role(s) of these homologs are yet to be clearly identified.

Friesen and Faris (2004) mapped the gene conferring Ptr ToxB sensitivity to the distal end of the short arm of chromosome 2B using the International Triticeae Mapping Initiative (ITMI) mapping population, which was derived from the synthetic hexaploid wheat W-7984 and the hexaploid variety ‘Opata 85’, and designated the gene Tsc2. The Tsc2 locus defined a major quantitative trait locus (QTL) associated with resistance to the race 5 isolate DW5 and accounted for 69% of the phenotypic variation in disease development. Therefore, a compatible Tsc2-Ptr ToxB interaction played a major role in the development of tan spot. However, the Tsc2-Ptr ToxB interaction was not the only factor responsible for disease because QTL with minor effects were also identified on chromosome arms 2AS and 4AL.

Studies on the inheritance and mapping of resistance to P. tritici-repentis race 5 isolates have also been conducted by Singh et al. (2008) who analyzed the inheritance of resistance to the race 5 isolate DW13 in multiple populations and reported that a single dominant gene governed resistance in each population. However, using conidia and culture filtrates derived from the same isolate, Singh et al. (2010) evaluated a mapping population developed from the hexaploid wheat lines ‘Steele-ND’ and ND375 and reported that a single recessive gene on the short arm of chromosome 2B governed resistance. The discrepancies in gene action between the two studies were attributed to variation in the expression of chlorotic symptoms caused by environmental influences.

The objectives of this study were to (i) validate the gene action and chromosomal location of Tsc2 in an intervarietal hexaploid wheat population, (ii) determine the effects of a compatible Tsc2-Ptr ToxB interaction on the development of disease caused by race 5 in the population, (iii) develop user-friendly polymerase chain reaction (PCR)-based markers suitable for marker-assisted selection (MAS) against Ptr ToxB sensitivity conferred by the Tsc2 locus, and (iv) evaluate the utility of rice (Oryza sativa L.) and Brachypodium distachyon (L.) P. Beauv. genomic sequences for fine-mapping of the Tsc2 region. Ptr ToxB is the only chlorosis-inducing proteinaceous HST identified so far and hence the characterization of the Tsc2 gene will provide knowledge regarding mechanisms underlying the Tsc2-Ptr ToxB interaction at the molecular level. Knowledge of the differences and similarities of the mechanisms leading to chlorosis and necrosis will advance our knowledge of the wheat–P. tritici-repentis pathosystem.


Materials and Methods

Plant Materials

A segregating population of 150 F2 plants derived from a cross between the Ptr ToxB-sensitive hexaploid wheat ‘Katepwa’ and the Ptr ToxB-insensitive hexaploid landrace Salamouni was developed initially. A total of 121 plants were advanced to the F7 generation by single seed descent (SSD) to develop recombinant inbred lines (RILs). Plants were grown in cones containing SB100 (Sun Gro Sunshine; Sun Gro Horticulture, Vancouver, BC) soil mix with 10 to 20 granules of Osmocote (Scotts Company LLC, Marysville, OH) added to each cone. Plants were advanced in the greenhouse at an average temperature of 21°C with a 16 h photoperiod. Three lines were later found to be largely heterozygous for the Tsc2 genomic region and were thus eliminated from the analysis. Therefore, the resulting Salamouni × Katepwa (SK) RIL population used for mapping and phenotypic analysis in this research consisted of 118 lines.

Disease Evaluations and Statistical Analysis

The SK population was screened with DW5, a race 5 isolate of P. tritici-repentis known to produce Ptr ToxB (Friesen and Faris, 2004). DW5 was grown on V8–potato dextrose agar (Difco PDA; Becton, Dickinson and Company, Sparks, MD) plates for 5 to 7 d in the dark, and inoculum was prepared for disease evaluations as described by Lamari and Bernier (1989) and Ali et al. (2010). Parents and the 118 SK RILs were planted in a completely randomized design (CRD) in three replicates for DW5 conidial inoculations. Each replicate consisted of a single cone (Stuewe and Sons, Inc., Corvallis, OR) per line with 3 plants per cone placed in racks of 98 (Stuewe and Sons, Inc.). Thus, an experimental unit consisted of 3 plants per line. The tan spot-susceptible hard red spring wheat ‘Grandin’ was planted in the borders of each rack to reduce any edge effect. Plants were inoculated until runoff at the two- to three-leaf stage with 3000 spores mL−1 and 2 drops of Tween20 (polyoxyethylene sorbitan monolaurate; J.T. Baker Chemical Co., Phillipsburg, NJ) per 100 mL of inoculum. Inoculated plants were placed in a mist chamber with 100% relative humidity at 21°C for 24 h and then subjected to 6 d of incubation in the growth chamber at 21°C under a 12 h photoperiod. Inoculated plants were rated using a 1 to 5 lesion type scale (Lamari and Bernier, 1989) at 7 d post-inoculation. Chi-square tests were conducted using the program Graphpad (http://www.graphpad.com/quickcalcs [verified 28 Oct. 2010]) and homogeneity of variances among the three replicates were determined by Bartlett's χ2 test using SAS (SAS Institute Inc., 2003). Mean separation of the genotypic means were determined by Fisher's protected LSD at an α level of 0.05.

Ptr ToxB Production and Screening

Cultures containing Ptr ToxB were obtained by expressing the ToxB gene using the same procedure as for SnTox3 described by Liu et al. (2009). The commercial kit developed for the constitutive expression and purification of recombinant proteins (Invitrogen, Carlsbad, CA), which includes the yeast strain Pichia pastoris X33 and the vector pGAPZA, was used for this purpose. The ToxB coding region was amplified from isolate DW5 complementary DNA (cDNA) using primer pair ToxB_LEcoRI (GAATTCATGCTACTTGCTGTGGCTATCCT) and ToxB_RXbaI (TCTAGACTAACAACGTCCTCCACTTGCCA) and cloned into the pCR4-TOPO vector using the TOPO TA cloning kit (Invitrogen). After confirmation for sequence identity, the ToxB gene was released from the pCR4-TOPO vector by restriction digestion with EcoRI and XbaI, cloned into the pGAPZA vector, and transformed into the wild-type yeast strain P. pastoris X33. Competent P. pastoris cells were prepared and transformed using the Pichia EasyComp kit (Invitrogen) as described in the user manual. Fully expanded secondary leaves were infiltrated with Ptr ToxB cultures, and the infiltrated plants were kept in the growth chamber at 21°C under a 12 h photoperiod. Plants were evaluated 4 d after infiltration and scored as sensitive or insensitive based on the presence or absence of chlorosis. One hundred fourteen F2 plants were infiltrated with the Ptr ToxB cultures two times (separated by 6 d), and the 118 lines of the SK RIL population along with parents were screened for reaction to Ptr ToxB cultures at five different times.

Simple Sequence Repeat Marker Identification and Bin-Mapped Expressed Sequence Tag Marker Development

Deoxyribonucleic acid (DNA) was isolated from the plant tissues of the entire SK population and of the parental lines as described by Faris et al. (2000). Linkage maps consisting of over 400 simple sequence repeat (SSR) markers spanning all 21 chromosomes were developed for the SK population, and details of the whole-genome maps will be provided elsewhere. Here, once a skeletal map of chromosome 2B was assembled, previously published genetic and physical maps of wheat were surveyed to identify additional SSR markers mapped to the short arm of chromosome of 2B, and they were selected from the following primer sets: MAG (Xue et al., 2008), GWM (Röder et al., 1998), WMC (Somers et al., 2004), HBG (Torada et al., 2006), CFD (Sourdille et al., 2004), and BARC (Song et al., 2005).

National Science Foundation (NSF)-wheat bin mapped expressed sequence tagged (EST) sequences from bin 2BS3 0.84–1.00 were downloaded from the Graingenes database (http://wheat.pw.usda.gov/west/binmaps [verified 28 Oct. 2010]). The computer software PRIMER3 (Rozen and Skaletsky, 2000) was used to design primers for the EST sequences to develop sequence-tagged site (STS) markers. Simple sequence repeat and EST-STS primer sets were used to amplify the parental DNA using PCR conditions as described in Lu et al. (2006), and amplified products were separated on 6% polyacryalmide gels, stained with SYBR Green II (Sigma, St. Louis, MO), and visualized using a Typhoon 6410 variable mode imager (GE Healthcare, Waukesha, WI). Markers revealing polymorphisms between the parents were then used to genotype the 118 individuals of the SK population.

When EST-STS markers were monomorphic between Salamouni and Katepwa, the corresponding EST clone was used as a probe for restriction fragment length polymorphism (RFLP) analysis. Restriction fragment length polymorphism analysis was conducted using the restriction enzymes ApaI, BamHI, BglII, DraI, EcoRI, EcoRV, HindIII, SacI, ScaI, and XbaI as described by Faris et al. (2000). The plasmids containing EST inserts were obtained from the NSF wheat-EST project. Probes for Southern hybridization were prepared by PCR amplification followed by gel purification of the insert fragments of the EST clones. Probes were labeled with (32P) dCTP by the random hexamer method (Feinberg and Vogelstein, 1983). Procedures for Southern blotting, probe hybridization, and membrane washing were done as described in Faris et al. (2000).

Comparative Mapping and Marker Development based on Colinearity with Rice and Brachypodium distachyon

Tentative consensus (TC) sequences corresponding to the sequences of the EST-based markers that mapped to chromosome 2B were identified through BLASTn searches of the Dana Farber Cancer Institute (DFCI) wheat gene index database release 12.0 (http://compbio.dfci.harvard.edu/cgi-bin/tgi/Blast/index.cgi [verified 28 Oct. 2010]). These TC sequences were then subjected to BLASTn and tBLASTx searches against the rice and Brachypodium distachyon genomic sequences using Gramene release 31.0 (http://www.gramene.org/Multi/blastview [verified 28 Oct. 2010]) and Brachyblast (http://blast.brachybase.org [verified 28 Oct. 2010]), respectively. The predicted proteins for the ESTs were identified by subjecting the TC sequences to BLASTx searches against the National Center for Biotechnology Information (NCBI) nonredundant database. An E value of e–20 was set as the threshold for significant matches for the searches conducted.

Additional markers were developed based on the sequences of genes residing in the corresponding regions of rice and Brachypodium distachyon chromosomes that were colinear with the Tsc2 region of wheat chromosome arm 2BS. Deduced cDNA sequences of 67 genes residing within a 1.37 Mb region of Brachypodium distachyon chromosome 5 that corresponded to the Tsc2 marker interval of wheat were downloaded from the Brachypodium web site (http://www.brachybase.org [verified 28 Oct. 2010]). Similarly, deduced cDNA sequences of 28 rice genes that reside within a 1.81 Mb region of rice chromosome 4 corresponding to the Tsc2 marker interval that had significant similarity to the downloaded Brachypodium distachyon sequences were downloaded from Gramene release 31.0 (http://www.gramene.org [verified 28 Oct. 2010]). Downloaded Brachypodium distachyon and rice cDNA sequences were used as queries in BLASTn searches of the DFCI wheat gene index database release 12.0 (http://compbio.dfci.harvard.edu/cgi-bin/tgi/Blast/index.cgi [verified 28 Oct. 2010]) to identify the corresponding wheat TC sequences. A total of 48 primer sets were developed from the identified wheat TC sequences using PRIMER3 and evaluated by PCR using the methods described above.

Linkage and Regression Analysis

Linkage analysis was performed using the computer program MAPMAKER V2.0 (Lander et al., 1987) for Macintosh, and the Kosambi mapping function (Kosambi, 1944) was used to calculate linkage distances. The marker order was verified using the “ripple” command with a LOD value of 3.0. Markers that could not be assigned to the map at a LOD value of 3 were placed in the most likely positions along the map.

Composite interval-regression mapping was conducted with the computer programs QGene (Joehanes and Nelson, 2008) and MapManager QTX (Manly et al., 2001) using the entire marker data set (>400 markers spanning all chromosomes) to determine the amount of variation in disease expression explained by a compatible Tsc2-Ptr ToxB interaction as described in Faris and Friesen (2009). A critical LOD threshold of 3.3 was determined by performing a permutation test with 1000 iterations.


Results

Genetic Analysis of Ptr ToxB Sensitivity

Salamouni and Katepwa exhibited insensitive and sensitive reactions to Ptr ToxB, respectively (Fig. 1). The SK population, which consists of 118 RILs, segregated in a ratio of 52:66 insensitive:sensitive when infiltrated with Ptr ToxB cultures, which fit the expected 1:1 ratio for a single host gene conferring Ptr ToxB sensitivity (χ2df = 1 1.66, p = 0.1975). A total of 114 F2 plants derived from a Salamouni × Katepwa cross were infiltrated with Ptr ToxB cultures and showed a segregation ratio of 91:23 sensitive: insensitive, which fit the expected 3:1 ratio for a single gene (χ2df = 2 1.41, p = 0.50) and indicated that Ptr ToxB sensitivity is conferred by the dominant allele.

Figure 1.
Figure 1.

Secondary leaves inoculated with conidia of DW5, a race 5 isolate produced by the tan spot fungus Pyrenophora tritici-repentis, or infiltrated with Ptr ToxB. A and B: Reaction of Salamouni (A) (average disease reaction type 1.8) and Katepwa (B) (average disease reaction type 3.7) to conidial inoculations with the P. tritici-repentis race 5 isolate DW5. C and D: Reaction of Salamouni (C) and Katepwa (D) infiltrated with Ptr ToxB. The boundaries of the infiltrated regions are marked in black.

 

Mapping the Tsc2 Locus using Simple Sequence Repeats and Bin-Mapped Expressed Sequence Tag-Derived Markers

Thirteen SSR markers were mapped to the chromosome 2B region in the SK population that corresponded to the wheat deletion bin 2BS3 0.84–1.00, which was the region expected to harbor Tsc2 (Fig. 2). Of the primer sets developed from 50 bin-mapped ESTs, 24 revealed polymorphisms between Salamouni and Katepwa. Six of these amplified fragments mapped to chromosome 2B (Table 1; Fig. 2). Ten ESTs that were monomorphic as STS markers revealed RFLPs when used as probes in Southern hybridization experiments, and three of these mapped to the chromosome 2B region corresponding to deletion bin 2BS3 0.84–1.00 (Table 1; Fig. 2). Tsc2 mapped 2.7 cM proximal to the SSR marker Xmag681 and 0.6 cM distal to the EST-STS marker XBE517745. The EST-RFLP marker XBE444541, which was later converted to an STS marker (see below), cosegregated with Tsc2. These results confirmed that Tsc2 is located within the 2BS3 0.84–1.00 deletion bin. The genetic map of the region developed using SSRs and bin-mapped EST-based markers consisted of 22 DNA markers in addition to the Tsc2 locus and spanned a genetic distance of 60.9 cM.


View Full Table | Close Full ViewTable 1.

Expressed sequence markers mapped on chromosome arm 2BS in the Salamouni × Katepwa recombinant inbred population. The source, primer sequences, annealing temperatures, and marker types are indicated.

 
Source Marker PCR† primers Annealing temperature (°C) Marker type‡ (enzyme)
2BS-3 XBM140322 AAGGCTCACCAACAACTCC 50 STS
CTCGGAACAGCAACATTACC
2BS-3 XBF200812 GCATTCCCTCTAACGACTGA 50 STS
TTCTTTGATAACCATCCGTAGG
2BS-3 XBE604773 GAGAGGCGCAAACAAAATAA 50 STS
AACATCCTCATAGCCATCCA
2BS-3 XBE444541§ TGGACCAGTATGAGA 55 STS
TTCTGGAGGATGTTGAGCAC
2BS-3 XBE517745 CTCACCTCCATTGCCTCTAA 50 STS
AGAACCGAAGATTGCTGATG
2BS-3 XBF202540 TGGTTATGGACAAGAGAAGAAAA 50 STS
AGGTAGAAATGAGGCGAGTG
2BS-3 XBF485266 CAGCAAAGAACACGGAAAGT 50 STS
GCAAGCACAGTAAAAGAAGCA
2BS-3 XBE606912 GTCCAGAAGACCTGCAAAGA 54 RFLP (HindIII)
AGACAAGGTGAACTCCCACA
2BS-3 XBF483211 GATACACCAATGACGGAACAA 50 RFLP (EcoRI)
GCCAAGAAGGCTCCAATAAG
Rice and Brachypodium distachyon colinearity XTC317202 AGGCATTTGGTCATTTTGG 50 STS
GAAGGCATACTCAACAGAAATCA
Rice and Brachypodium distachyon colinearity XTCK208937 TCTCATTAATGGCGCTCTCC 52 STS
GAGGTTTCTTCTTGCGCTTG
Rice and Brachypodium distachyon colinearity XTC313504 CTCGTCATGGGGTGACTTTT 50 STS
TGGATCTGCTCGTCAAAGTG
Rice and Brachypodium distachyon colinearity XTC307686 AAGTCGCGTTGATGCAATTA 54 STS
TTGACGTTTGCAACAGTTGAT
Brachypodium distachyon colinearity XTC339813 CGTTCTTTGCACATCACTAA 50 STS
TGGAAATGCCACATCACTGT
PCR, polymerase chain reaction.
STS, sequence-tagged site; RFLP, restriction fragment length polymorphism.
§Marker XBE444541 was initially mapped as an RFLP marker and later converted to a PCR-based STS marker.
Figure 2.
Figure 2.

Molecular mapping of the Tsc2 locus in the recombinant inbred population derived from Salamouni × Katepwa. The genetic linkage map of the Tsc2 region (middle) corresponds to the deletion bin 2BS3 0.84–1.00 on the physical map (left). Markers are indicated to the right of the genetic map. Microsatellite simple sequence repeat (SSR) markers are shown in black; sequence-tagged site (STS) and restriction fragment length polymorphism (RFLP) markers derived from bin-mapped expressed sequence tags (ESTs) are shown in blue and burgundy, respectively; the marker XBE444541, which was derived from a bin-mapped EST and initially mapped as an RFLP then converted to an STS marker, is shown in bright red; and markers developed from ESTs identified based on colinearity with rice and Brachypodium distachyon are shown in green. The composite interval regression map of the Tsc2 region after inoculation with the Pyrenophora tritici-repentis race 5 isolate DW5 is on the right. The critical logarithm of odds (LOD) threshold of 3.30 is indicated by the dotted line, and the LOD scale is indicated at the bottom.

 

Comparative Analysis and Additional Marker Development based on Colinearity with Rice and Brachypodium distachyon

The sequences of the ESTs that mapped to chromosome arm 2BS in the SK population were used as query sequences to search the rice and Brachypodium distachyon genome sequences to identify putative orthologs. Six of the nine mapped wheat EST sequences had similarity to sequences on Brachypodium distachyon chromosome 5 (Table 2), and five of these six had similarity to sequences on rice chromosome 4 (Table 3). One EST (BF483211), which had similarity to a sequence on Brachypodium distachyon chromosome 5, had similarity to a sequence on rice chromosome 10 (Table 3). The remaining three mapped EST sequences, BM140322, BF200812, and BE606912, had no significant similarity to any rice or Brachypodium distachyon sequences (Tables 2 and 3). Furthermore, BM140322 and BE606912 had no similarity to any protein sequences in the NCBI database, whereas putative homologs for the other seven mapped ESTs were identified (Table 4).


View Full Table | Close Full ViewTable 2.

Putative Brachypodium distachyon orthologs of the expressed sequence tag (EST) or tentative consensus (TC) sequences mapped on chromosome 2B in the Salamouni × Katepwa recombinant inbred population based on significant BLASTn and tBLASTx hits to Brachypodium distachyon genomic sequences.

 
BLASTn tBLASTx
Marker TC Gene e value Position (bp) Chr.† Gene e value Position (bp) Chr.
XBM140322 TC312601 NS‡ NS
XBF200812 TC339576 NS Bradi5g214001 2e–81 24,030,676 5
XTC317202 TC317202 Bradi5g01430 8e–94 1399,986 5 Bradi5g014301, 02 2e–95 1400,019 5
XBF483211 TC319144 Bradi5g017401 3e–65 1760,470 5 Bradi5g017401 1e–119 1760,449 5
XCK208937 N/A§ Bradi5g018701 1e–21 1898,167 5 Bradi5g018701 7e–27 1897,704 5
XTC313504 TC313504 No hits 2e–43 1791,258 5 No hits 0 1791,751 5
XBE604773 TC288658 Bradi5g01230 2e–83 1144,639 5 Bradi5g012301 0 1144,638 5
XTC307686 TC307686 No hits 2e–66 4218 5 Bradi5g013401 1e–106 1263,938 5
XBE606912 TC320680 NS NS
XTC339813 TC339813 Bradi5g01940 0 2011,335 5 Bradi5g019401 0 2011,053 5
XBE444541 TC289693 Bradi5g02160 1e–77 2253,564 5 Bradi5g021601 1e–159 2252,432 5
XBE517745 TC323680 Bradi5g023001 4e–62 2408,534 5 Bradi5g023001 1e–142 2408,533 5
XBF202540 TC358868 Bradi5g02400 1e–33 2518,619 5 Bradi5g024001 –04 2e–78 2518,619 5
XBF485266 TC296434 Bradi5g03810 1e–104 4774,323 5 Bradi5g038101 1e–148 4772,425 5
Chr., chromosome.
NS, not significant.
§N/A, not available.

View Full Table | Close Full ViewTable 3.

Putative rice orthologs of the expressed sequence tag (EST) or tentative consensus (TC) sequences mapped on chromosome 2B in the Salamouni × Katepwa recombinant inbred population based on significant BLASTn and tBLASTx hits to rice genomic sequences.

 
BLASTn tBLASTx
Marker TC Gene e value Position (bp) Chr.† Gene e value Position (bp) Chr.
XBM140322 TC312601 NS‡ NS
XBF200812 TC339576 NS LOC_Os02g32770 2.70e–29 19,453,542 2
XTC317202 TC317202 LOC_OS04g02870 4.90e–159 1120,206 4 LOC_OS04g02870 130e–66 1118,608 4
XBF483211 TC319144 LOC_Os10g22560 580e–19 11,621,740 10 LOC_Os07g01070 430e–55 41,699 7
XCK208937 N/A§ LOC_Os04g02510 82e–94 913,265 4 LOC_Os04g02510 15e–34 913,703 4
XTC313504 TC313504 LOC_Os04g27340 600e–21 15,987,294 4 LOC_Os04g27670 14e–119 16,180,747 4
XBE604773 TC288658 LOC_Os04g04254 190e–292 1987,260 4 LOC_Os04g04254 540e–189 1987,261 4
XTC307686 TC307686 No hits 38e–59 30,386 9 LOC_Os04g03990 11e–68 1833,746 4
XBE606912 TC320680 NS NS
XTC339813 TC339813 NS LOC_Os04g02110 340e–124 684,478 4
XBE444541 TC289693 LOC_Os04g01590 320e–282 399,306 4 LOC_Os04g01590 130e–137 399,307 4
XBE517745 TC323680 LOC_Os04g01480 290e–211 325,319 4 LOC_Os04g01480 160e–120 327,479 4
XBF202540 TC358868 LOC_Os04g01230 170e–53 179,571 4 LOC_Os04g01230 450e–50 178,955 4
XBF485266 TC296434 LOC_Os04g14790 200e–203 8304,461 4 LOC_Os04g14790 690e–118 8302,979 4
Chr., chromosome.
NS, not significant.
§N/A, not available.

View Full Table | Close Full ViewTable 4.

Putative proteins of the expressed sequence tag (EST) markers mapped to wheat chromosome arm 2BS based on BLASTx searches.

 
GenBank accession Marker TC† Predicted protein based on NCBI‡ BLASTx e value
BM140322 XBM140322 TC312601 N/A§ NS¶
BF200812 XBF200812 TC339576 cytochrome P450 [Triticum aestivum] 6e–55
N/A XTC317202 TC317202 Os04g0118900 [Oryza sativa (japonica cultivar-group)] 2e–101
BF483211 XBF483211 TC319144 hypothetical protein SORBIDRAFT_01g027250 [Sorghum bicolor] 1e–91
N/A XCK208937 CK208937 hypothetical protein OsI_14623 [Oryza sativa indica Group] 4e–33
N/A XTC313504 TC313504 OSIGBa0106G08.3 [Oryza sativa (indica cultivar-group)] 3e–164
BE604773 XBE604773 TC288658 UDP-glucose:sterol glucosyltransferase [Avena sativa] 0
N/A XTC307686 TC307686 Os04g0129200 [Oryza sativa (japonica cultivar-group)] 7e–96
BE606912 XBE606912 TC320680 N/A NS
N/A XTC339813 TC339813 Vrga1 [Aegilops ventricosa] 3e–153
BE444541 XBE444541 TC289693 hypothetical protein SORBIDRAFT_06g000580 [Sorghum bicolor] 9e–173
BE517745 XBE517745 TC323680 hypothetical protein OsI_14559 [Oryza sativa indica Group] 1e–164
BF202540 XBF202540 TC358868 OSIGBa0123D13.3 [Oryza sativa (indica cultivar-group)] 8e–112
BF485266 XBF485266 TC296434 hypothetical protein OsJ_13895 [Oryza sativa japonica Group] 3e–143
TC, tentative consensus.
NCBI, National Center for Biotechnology Information.
§N/A, not applicable.
NS, not significant.

The SK 2BS genetic linkage map and Brachypodium distachyon chromosome 5 were colinear with only one exception (Fig. 3). The sequence represented by marker XBE604773 was inverted relative to that of marker XBF483211 in Brachypodium distachyon compared to wheat. Colinearity was also well conserved among the five EST markers mapped to wheat 2BS and their putative orthologs on rice chromosome 4 except that the sequence represented by marker XBF485266 was inverted relative to the positions of the other four markers.

Figure 3.
Figure 3.

Comparison of the Tsc2 region in wheat chromosome 2BS (middle) with rice chromosome 4 (left) and Brachypodium distachyon chromosome 5 (right). Markers developed based on bin-mapped expressed sequence tags (ESTs) are indicated in black, and markers developed based on colinearity with rice and Brachypodium distachyon are indicated in bright red. The Mb positions of colinear genes are indicated to the left of rice chromosome 4 and to the right of Brachypodium distachyon chromosome 5. Hatched regions of rice chromosome 4 indicate they are not to scale.

 

The comparative analysis indicated that good levels of colinearity existed within a 1.81-Mb region of rice chromosome 4, a 1.37-Mb region of Brachypodium distachyon chromosome 5, and the region between the markers XBE604773 and XBF202540 on wheat chromosome 2B (Fig. 3). Forty-eight primer sets were developed from gene sequences within the 1.37-Mb segment of Brachypodium distachyon, and 17 of these revealed polymorphisms between Salamouni and Katepwa. Of these 17, five (XTC317202, XCK208937, XTC313504, XTC307686, and XTC339813) detected loci on chromosome 2B and were placed on the linkage map (Fig. 2 and 3). XTC339813 cosegregated with the SSR marker Xmag681, and the remaining four loci were more distal to Tsc2.

The addition of the five markers developed based on colinearity with rice and Brachypodium distachyon to the wheat map revealed additional disruptions in colinearity between wheat chromosome arm 2BS and the syntenic regions of Brachypodium distachyon chromosome 5 and rice chromosome 4. For example, the positions of XCK208937 and XTC313504 were inverted on the wheat genetic map compared to Brachypodium distachyon (Fig. 3). Similarly, the positions of markers XTC317202 and XCK208937 were inverted relative to the positions of markers XBE604773 and XTC307686 on the wheat map compared to rice. Also, the rice homolog for the sequence represented by marker XTC313504, which was selected for marker development based on its position in the colinear region of Brachypodium distachyon chromosome 5, was located at a position near the distal end of the long arm of rice chromosome 4 more than 14 Mb from the region corresponding to the Tsc2 locus.

With the addition of the five markers developed based on colinearity with rice and Brachypodium distachyon, the wheat genetic map of the 2BS3 0.84–1.00 deletion interval developed in the SK population consisted of 27 markers spanning 60.9 cM and had a marker density of one marker per 2.3 cM. Tsc2 cosegregated with XBE444541 and was delineated to a 3.3-cM interval flanked by the locus detected by the SSR marker Xmag681 and the EST-STS marker XTC339813 on the distal side and the EST-STS marker XBE517745 on the proximal side.

Conversion of XBE444541 to a Polymerase Chain Reaction Marker and Genotypic Evaluation of Ptr ToxB Sensitive and Insensitive Wheat Cultivars

As mentioned previously, the EST-based marker XBE444541, which cosegregated with Tsc2, was initially mapped as a RFLP marker. To convert XBE444541 into a PCR-based marker, the BE444541 EST sequence, the corresponding consensus sequence (TC289693) and the sequence of the putative rice ortholog (LOC_Os04 g01590) were aligned using ClustalW (http://www.ebi.ac.uk/Tools/clustalw2/index.html [verified 28 Oct. 2010]). Eight primer sets were developed from the TC sequence by targeting the boundaries of introns identified based on annotation of the rice gene sequence. Several of the primer pairs revealed indel polymorphisms between Salamouni and Katepwa, and the one giving the clearest profile was selected for genotyping the SK population (Table 1). The XBE444541 EST-STS marker cosegregated with the corresponding RFLP marker confirming that both represent the same locus and cosegregate with Tsc2.

To evaluate the utility of the XBE444541 EST-STS marker for use in MAS programs, seven Ptr ToxB-insensitive and seven Ptr ToxB-sensitive wheat cultivars were genotyped. A 340-bp fragment amplified in Katepwa was specific to Ptr ToxB-sensitive wheat genotypes, whereas Salamouni and the other Ptr ToxB-insensitive genotypes yielded a 505-bp allele (Fig. 4).

Figure 4.
Figure 4.

Polyacrylamide (top) and agarose (bottom) gel electrophoresis of polymerase chain reaction (PCR) products amplified from seven Ptr ToxB-insensitive genotypes (lanes 2–8; cultivars Salamouni through ‘Knudson’) and seven Ptr ToxB-sensitive genotypes (lanes 9–15; cultivars Katepwa through 6B662) with the primer set for marker XBE444541. Lanes are annotated across the top. A 1 kb ladder is shown in lanes 1 and 16.

 

Effects of a Compatible Tsc2-Ptr ToxB Interaction on Tan Spot Development in the Salamouni × Katepwa Population

The average disease reaction types for Salamouni and Katepwa after inoculation with the race 5 isolate DW5 were 1.8 and 3.7 respectively (Table 5; Fig. 1). The three replicates of the SK population inoculations were homogeneous based on Bartlett's χ2 test for homogeneity (χ2df = 2 3.35, p = 0.1868) and therefore average reaction types were calculated for each RIL and used in the analysis. The average disease reaction types of the SK population ranged from 1.5 to 4.0 with an overall mean of 2.8. The mean disease reaction type of Ptr ToxB-sensitive RIL was 3.2 and ranged from 2.0 to 3.8, whereas the mean disease reaction type of Ptr ToxB-insensitive RILs was 2.3 and ranged from 1.3 to 3.8 (Table 5; Fig. 5).


View Full Table | Close Full ViewTable 5.

Average and range of disease reaction types of parents and recombinant inbred lines of the Salamouni × Katepwa population for the two allelic state combinations for Tsc2 after inoculation with conidia of Pyrenophora tritici-repentis isolate DW5.

 
Genotype Average disease reaction type Reaction type range
Salamouni 1.8 1.5– 2.0
Katepwa 3.7 3.5– 4.0
Tsc2 Tsc2 3.2† 2.0– 3.8
tsc2 tsc2 2.3† 1.3– 3.8
Average disease reaction type of Tsc2 Tsc2 is significantly different from that of the tsc2 tsc2 at the 0.05 level of probability.
Figure 5.
Figure 5.

Histogram of the average tan spot disease reaction types of the Ptr ToxB-insensitive and-sensitive recombinant inbred lines versus frequency in the Salamouni × Katepwa population.

 

Composite interval regression mapping indicated that the Tsc2 locus defined the peak of a major QTL with an LOD of 20.02 on chromosome 2B (Fig. 2). The Tsc2 locus explained 54% of the variation in disease expression caused by the DW5 isolate, and resistance was contributed by Salamouni, the Ptr ToxB-insensitive parent.


Discussion

Wheat–P. tritici-repentis interactions have gained much attention over the past few decades due to the devastating impacts of tan spot on wheat production throughout the world. To date, three of the HSTs produced by the tan spot fungus, Ptr ToxA, Ptr ToxB, and Ptr ToxC, have been characterized and the chromosomal locations of the corresponding host sensitivity genes, Tsn1 (Faris et al., 1996), Tsc1 (Effertz et al., 2002), and Tsc2 (Friesen and Faris, 2004) have been reported. Of the three wheat–P. tritici-repentis interactions, only Tsn1-ToxA has been studied in detail.

Tsc2 was initially mapped to chromosome arm 2BS in the ITMI population, which was developed by crossing a synthetic hexaploid wheat W-7984 with the hard red spring wheat variety Opata 85. W-7984 was synthesized from the durum wheat variety ‘Altar 84’ and Aegilops tauschii accession CI 18-WPI 219. The B genome donor in the ITMI population, Altar 84, is a tetraploid and was shown to be sensitive to Ptr ToxB whereas Opata 85 was insensitive. Therefore, the Tsc2 gene was derived from the durum variety Altar 84. In this study, the genomic position of Tsc2 harbored by the hexaploid variety Katepwa was also located on 2BS, which indicates that Ptr ToxB sensitivity is controlled by the Tsc2 locus on 2BS in both tetraploid and hexaploid wheat.

Previous reports regarding the inheritance of resistance to tan spot race 5 isolates have been in disagreement. Singh et al. (2008) reported that a single dominant gene governed resistance to race 5, whereas Singh et al. (2010) indicated that a single recessive gene was responsible for conferring resistance. Our results agree with the latter in that analysis of an F2 population with Ptr ToxB clearly demonstrated that a single dominant gene governs sensitivity, and because sensitivity is highly correlated with susceptibility, resistance to isolate DW5 would primarily be governed by the recessive tsc2 allele. Investigating gene action and inheritance by conidial inoculations is difficult due to possible environmental influences, the effects of minor genes on conferring resistance to race 5 (Friesen and Faris, 2004), and the fact that experiments involving inoculation of F1 and F2 plants cannot be replicated. However, Ptr ToxB infiltrations, especially with Pichia-produced cultures, circumvent the effects of other minor genes, are less affected by environmental variables, and can be repeated multiple times on the same plant to obtain accurate results.

The bin-mapped ESTs provide a useful source of sequences for marker development, and they have been used extensively to saturate genomic regions of wheat that harbor targeted loci (Lu et al., 2006; Reddy et al., 2008; Zhang et al., 2009). Here, we mapped nine markers derived from bin-mapped ESTs to the Tsc2 region on 2BS. While this is only 18% of the 50 ESTs selected for marker development, additional efforts to identify single nucleotide polymorphisms (SNPs) through allele sequencing would likely prove to be effective for mapping more of the ESTs to the Tsc2 region in the SK population.

The usefulness of rice and Brachypodium distachyon genomic information in the development of markers and genomic analysis of the Tsc2 region in wheat was also investigated and led to the development of five additional markers near the Tsc2 locus. Both Brachypodium distachyon chromosome 5 and rice chromosome 4 were perfectly colinear with the wheat Tsc2 region between markers XTC339813 and XBF202540. However, some disruptions in colinearity were observed between wheat and Brachypodium distachyon in the region distal to Tsc2 and between wheat and rice in regions both proximal and distal to Tsc2. Regardless, it is evident that the degree of colinearity between wheat chromosome arm 2BS and Brachypodium distachyon chromosome 5 was better than that of 2BS and rice chromosome 4 at the macro level of resolution, which agrees with other studies demonstrating that Brachypodium distachyon is more closely related to wheat than rice is (Vogel et al., 2006; Bossolini et al., 2007; Faris et al., 2008; Huo et al., 2009). Therefore Brachypodium distachyon genomic information may be more useful for conducting further genomic analysis and additional marker development in wheat compared to rice. The Brachypodium distachyon orthologs of markers XTC339813 and XBE517745, which flank Tsc2, lie approximately 390 kb apart. Forty-three genes lie within this interval, of which the majority have either no significant hits to any proteins of known function or code for yet unidentified hypothetical proteins. Therefore, none of these genes seem to be strong candidates for Tsc2. However, this gene information could be useful for the development of additional markers for use in targeting the Tsc2 locus.

Pyrenophora tritici-repentis race 5 isolates were first identified in Algeria (Orolaza et al., 1995) and later found in North Dakota (Ali et al., 1999). A primary objective of this research was to develop markers tightly linked to the Tsc2 locus that would be suitable for use in MAS schemes. Marker-assisted selection using codominant markers is less expensive and less time consuming compared to conventional disease screening or toxin infiltrations, especially when backcrossing to pyramid recessive resistance genes because genotypes that are homozygous susceptible cannot be distinguished from heterozygotes when screening by toxin infiltrations or spore inoculations. The PCR-based marker XBE444541, which cosegregates with Tsc2, will be useful for high-resolution mapping and eventual cloning of Tsc2. In addition, the evaluation of XBE444541 in 14 wheat cultivars indicates the potential diagnostic capabilities of this marker suggesting that it should be useful for association mapping studies and MAS schemes. The SSR marker Xmag681 and the EST-STS markers XTC317202 and XBE517745, which together delineate Tsc2 to a 3.3 cM interval, are all viable alternatives for use in MAS against Ptr ToxB sensitivity.

Analysis of a compatible Tsc2-Ptr ToxB interaction in the SK population confirmed that it plays a major role in conferring susceptibility to race 5 isolates of P. tritici-repentis by explaining 54% of the variation in disease expression. Although genome-wide QTL scans revealed no additional loci significantly associated with disease caused by DW5 (data not shown), some Ptr ToxB-insensitive lines were susceptible to the disease (Fig. 5) suggesting that other factors with minor effects could be involved as well. The reaction type ranges for Tsc2/Tsc2 (2.0–3.8) and tsc2/tsc2 (1.3–3.8) allelic combinations also suggest that there are other factors contributing to disease development in the SK population other than the Tsc2-Ptr ToxB interaction. Friesen and Faris (2004) reported three QTL with minor effects for resistance to P. tritici-repentis race 5 residing on chromosome arms 2AS, 4AL, and 2BL. Others have reported the action of minor QTL and race nonspecific QTL as well. For example, Chu et al. (2008) reported novel QTL located on 2AS and 5BL that conferred resistance to P. tritici-repentis races 1, 2, and 5, and Faris and Friesen (2005) reported QTL on chromosome arms 1BS and 3BL that conferred resistance to races 1, 2, 3, and 5. These results expose the complexity of the wheat–P. tritici-repentis pathosystem and emphasize the importance of conducting replicated experiments and using QTL analysis for characterizing wheat–P. tritici-repentis interactions.

Acknowledgments

The authors thank Dr. Chenggen Chu for assistance with statistical analyses. This research was supported by USDA-ARS CRIS projects 5442-22000-033-00D and 5442-22000-043-00D. Mention of trade names or commercial products in this article is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the U.S. Department of Agriculture.

 

References

Footnotes

  • All rights reserved. No part of this periodical may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or any information storage and retrieval system, without permission in writing from the publisher. Permission for printing and for reprinting the material contained herein has been obtained by the publisher.

Comments
Be the first to comment.



Please log in to post a comment.
*Society members, certified professionals, and authors are permitted to comment.