View Full Table | Close Full ViewTable 1.

Dates of fertilization (FE) and sample collection (SC).

 
Date Treatment†
FE SC FE SC FE SC FE SC FE SC FE SC FE SC FE SC FE FE SC FE
4 May 1
7 May 1-1
10 May 1-2 2
13 May 1-3 2-1
16 May 2-2 3
19 May 2-3 3-1
22 May 3-2 4
25 May 3-3 4-1
28 May 4-2 5
31 May 4-3 5-1
3 June 5-2 6
6 June 5-3 6-1
9 June 6-2 7
12 June 6-3 7-1
15 June 7-2 8
18 June 7-3 8-1
21 June 8-2 9
24 June 8-3 9-1
27 June 9-2 10
30 June 9-3 10-1
3 July 10-2
6 July 10-3
For every fertilizer treatment, samples were collected three times at 3-d intervals.



View Full Table | Close Full ViewTable 2.

Primers used for quantitative real-time polymerase chain reaction (RT-PCR).

 
Primers Sequence (5’–3’) Use
P01 GCAGGACTGCAGCTGACTGACTACT30VN† cDNA synthesis
P02 GACCAGTGGTATCAACGCAGAGTACGCGGG
Actin For‡ TCACCACTACTGCTGAACG Internal control
Actin Rev CTTCTGGACAACGGAATC
GDH-For TGAATGCGCTGGCGGCAACCAAC VvGDH quantitative RT-PCR
GDH Rev TAGGCTTCCCAACCCCTAAGGA
NiR For ATGGCTTCTATCTCTGTTCC VvNIR quantitative RT-PCR
NiR Rev TCAGTCTTCAGCTTCTTCTTCCCT
NR For ATGGCGGCATCCGTTGATAATCG VvNR quantitative RT-PCR
NR Rev TCAGAACACCAGCAAAGAAT
GS For ATGTACATACTAAGGAGGGT VvGS quantitative RT-PCR
GS Rev TCAAAATTCTATGGAAAGCC
AS For ATGTGCGGAATACTTGCAGTTCTGGG VvAS quantitative RT-PCR
AS Rev GGGTGCAGTTACTTCCATAATCCTCGG
PHT14 For GTACTCTTGCCGGACAGCTC VvPHT1–4 quantitative RT-PCR
PHT1–4 Rev GCCAGAACCTGAAGAAGCAC
PHT2–1 For CAAGGCTTTAGCCTGTGGAG VvPHT2–1 quantitative RT-PCR
PHT2–1 Rev CATGGGCAAATGACATGAAG
PHO-1 For ACCCAAGTTGACGCCATT VvPHO quantitative RT-PCR
PHO-2 Rev GAGCAGACTATGTTGCGAATG
PAP For ACCTGATTATTCTGCTTTCCG VvPAP quantitative RT-PCR
PAP Rev TCCTGCTTCCCAGCTTACTT
SIRK For GCTTTCAGCCTCCTGTTCAC VvSIRK quantitative RT-PCR
SIRK Rev CACCAATCCAGGTTCGTTCT
SORK For AGGAAGCAACGAAGACGAAA VvSORK quantitative RT-PCR
SORK Rev CACGAGCCTGCATAGTTCAA
KUP1 For TGAGCTTTGAAACATGGGAAGACT VvKUP1 quantitative RT-PCR
KUP1 Rev TTCTTGTTACCAAGCCTTCCGG
KUP2 For ATGCTTCCTGCCATTTCCACATA VvKUP2 quantitative RT-PCR
KUP2 Rev GGTTGGCATGGTTTATATCGTCTG
T30VN: 30 repetitive T; V indicates A, G, or C; N indicates A, G, C, or T.
For, forward; Rev, reverse; VvAS, V. vinifera asparagine synthetase; VvGDH, V. vinifera glutamate dehydrogenase; VvGS, V. vinifera glutamine synthetase; VvNiR, V. vinifera nitrite reductase; VvNR, V. vinifera nitrate reductase; VvKUP1, V. vinifera K+ uptake and metabolism permeases 1; VvKUP2, V. vinifera K+ uptake and metabolism permeases 2; VvSIRK, V. vinifera inward rectifying shaker-like K+ channel; VvSORK, V. vinifera outward rectifying shaker-like K+ channel; VvPAP, V. vinifera purple acid phosphatase; VvPHO1, V. vinifera phosphate (Pi) transporter 1; VvPHT1–4, V. vinifera phosphate transporter 1–4; VvPHT2–1, V. vinifera phosphate transporter 2–1