View Full Table | Close Full ViewTable 1.

Allele-specific polymerase chain reaction primers for single nucleotide polymorphism (SNP) markers tightly flanked the significant sunflower Sclerotinia basal stalk rot resistance quantitative trait loci (QTL) on linkage groups 10 and 17.

 
QTL Flanking SNP markers Primer name Primer sequence† Marker property
Qbsr-10.1 S10_281294015 F1 GCAACAGGAACCAGCTATGAC GTATATTGTATTTATACTAGCTTGATACATACA Codominant
F2 GCAACAGGAACCAGCTATGACATGAC GTATATTGTATTTATACTAGCTTGATACACGCC
R TTTCCCATAGGCACCTTTCC
S10_288646223 F1 GCAACAGGAACCAGCTATGAC GCTTGGACCGAATGAATTAACAAATC Codominant
F2 GCAACAGGAACCAGCTATGACATGAC GCTTGGACCGAATGAATTAACAGGTG
R TCGCGTTATCTCACTCGTTTCTTT
S10_288646244 F1 GCAACAGGAACCAGCTATGAC GATCAAAGAAACGAGTGAGATAGCG Codominant
F2 GCAACAGGAACCAGCTATGACATGAC GATCAAAGAAACGAGTGAGATGACA
R GCAACCAAGTATGAATGCATGACAA
S10_288646251 F1 GCAACAGGAACCAGCTATGAC CGAGTGAGATAACGCGACAGA Codominant
F2 GCAACAGGAACCAGCTATGACATGAC CGAGTGAGATAACGCGATGGG
R GCAACCAAGTATGAATGCATGACAA
Qbsr-17.1 SFW02170 F1 GCAACAGGAACCAGCTATGAC GTTGTACTCTTGCTCCTTTTGTTCGAT Codominant
F2 GCAACAGGAACCAGCTATGACATGAC GTTGTACTCTTGCTCCTTTTGTTTAAC
R GAAGATACGGTTGGTACAGATTCTGTTC
S17_228661362 F1 GCAACAGGAACCAGCTATGACGGGCATGATAGACCCACATATTAG Codominant
F2 GCAACAGGAACCAGCTATGACATGACGGGCATGATAGACCCACATACCAA
R CCGAACCTCAATCCCACCAA
NSA_002284 F1 GCAACAGGAACCAGCTATGAC GAACATATACATCGATTCAAGCGACA Codominant
F2 GCAACAGGAACCAGCTATGACATGAC GAACATATACATCGATTCAAGCAGCG
R CTTTCAAGAGCCCTAGTCCAGT
NSA_000632 F1 GCAACAGGAACCAGCTATGAC CGTATCGTTTTTTTTATACAAACAATACTCA Codominant
F2 GCAACAGGAACCAGCTATGACATGAC CGTATCGTTTTTTTTATACAAACAATATCCG
R GCATAATGCAGGGCTTCCTTC
SFW01832 F1 GCAACAGGAACCAGCTATGAC ATTATCAGCATCGGGGAGC Codominant
F2 GCAACAGGAACCAGCTATGACATGAC ATTATCAGCATCGGGAGGT
R TGGGATGCCTCTCTTGAAGC
The tail sequence is in bold and the additional five-base oligonucleotide insertion in AS-primer F2 is bold and underlined; the italic indicates SNP and strikethrough is the introduced mismatch.



View Full Table | Close Full ViewTable 2.

Analysis of variance (ANOVA) for Sclerotinia basal stalk rot (BSR) disease incidence (DI) scores among sunflower parents and 106 recombinant inbred lines (RILs) derived from the cross HA 44 × RHA 439 screened in multienvironments during 2012 through 2014.

 
Component df Variance estimate Confidence limit (0.05)
F/Z value† p-value > F/Z
Lower Upper
Environment 4 164.7 <0.0001
Replication (environment) 9 σ2r = 13.19 5.42 66.09 1.71 0.0439
Genotype 107 σ2g = 161.81 119.21 232.30 5.92 <0.0001
Genotype × environment 428 σ2gl = 61.15 39.35 107.90 3.95 <0.0001
Error 963 σ2e = 345.73 315.86 380.07
In the PROC MIXED model, environments were considered fixed and, therefore, subject to F-test (values in bold). F, Fisher’s F-test statistic; Z, Z-test statistic.



View Full Table | Close Full ViewTable 3.

Spearman rank correlations (ρ) between Sclerotinia basal stalk rot (BSR) disease incidence (DI) scores of 106 sunflower recombinant inbred lines screened at five field trials during 2012–2014 growing seasons.

 
Environment Crookston 2012 Crookston 2013 Carrington 2014 Grandin 2014
Carrington 2012 0.29** 0.55*** 0.53*** 0.51***
Crookston 2012 0.46*** 0.34** 0.48***
Crookston 2013 0.46*** 0.66***
Carrington 2014 0.57***
**Significant at the 0.01 probability level.
***Significant at the 0.001 probability level.



View Full Table | Close Full ViewTable 4.

Quantitative trait loci (QTL) for Sclerotinia basal stalk rot (BSR) resistance identified in the HA 441 × RHA 439 recombinant inbred line sunflower population in five individual environments.

 
Environment Linkage group Peak QTL position Flanking markers† (cM position)
LOD‡ Additive effect§ R2 1-LOD interval
Left Right
cM
Carrington 2012 4 32.0 S4_147688288 (29.1) S4_135190076 (33.1) 3.3 −7.2 6.4 27.9–34.4
10 66.5 S10_288646223 (66.5) S10_281294015 (67.5) 8.6 14.4 23.0 63.8–67.3
Crookston 2012 10 60.2 S10_247683641 (60.1) S10_253471019 (60.7) 5.5 8.8 16.8 57.0–61.2
16 87.3 S16_157591485 (87.3) S16_137964301 (87.9) 3.7 6.8 10.5 82.1–92.5
17 23.9 SFW2170 (23.699) S17_228661362 (23.987) 3.1 −6.2 8.36 22.7–24.8
Crookston 2013 10 60.2 S10_247683641 (60.1) S10_253471019 (60.7) 7.1 11.6 18.8 59.5–61.3
11 83.2 S14_148877201 (83.2) S14_148877253 (83.4) 3.6 7.7 8.6 80.9–84.4
17 23.9 SFW2170 (23.699) S17_228661362 (23.987) 3.1 −8.6 12.1 21.2–27.0
Carrington 2014 9 45.0 S9_153762438 (45.0) S9_158145790 (46.6) 3.2 −3.5 9.3 44.5–46.0
10 65.0 S10_273692455 (65.0) S10_271770211 (65.1) 6.9 4.0 22.0 63.0–65.1
Grandin 2014 10 57.9 S10_150172489 (57.9) S10_248236249 (58.8) 12.0 9.9 28.9 57.0–60.0
17 24.0 S17_228661362 (23.987) NSA_002284(24.383) 7.0 −8.6 26.4 23.6–24.3
SNP markers nearest to the QTL pick position are underlined.
LOD, logarithm of odds.
§Additive effect of the QTL was measured in disease incidence (%) of the BSR. Positive additive effects indicate that the RHA 439 parent contributed to the BSR resistance, while the negative additive effects indicate that the HA 441 parent contributed the resistance.
Percentage of phenotypic variance explained by the QTL in the population.



View Full Table | Close Full ViewTable 5.

Quantitative trait loci (QTL) for Sclerotinia basal stalk rot (BSR) resistance identified in combined analysis using integrated disease incidence data collected in HA 441 × RHA 439 recombinant inbred line sunflower population across five environments.

 
Linkage
group
Peak QTL position Flanking markers† (cM position)
LOD‡ Additive
effect§
R2 1-LOD interval
Left Right
cM
10 66.5 S10_288646223 (66.5) S10_281294015 (67.5) 14.1 9.5 31.6 65.8–67.4
17 23.9 SFW2170 (23.699) S17_228661362 (23.987) 6.9 −5.2 20.2 22.2–26.0
SNP markers nearest to the QTL pick position are underlined.
LOD, logarithm of odds.
§Additive effect of the QTL was measured in disease incidence (%) of the BSR. Positive additive effects indicate that the RHA 439 parent contributed to the BSR resistance, while the negative additive effects indicate that the HA 441 parent contributed the resistance.
Percentage of phenotypic variance explained by the QTL in the population.